ID: 1044504987

View in Genome Browser
Species Human (GRCh38)
Location 8:93006773-93006795
Sequence CTCCTCCCTCTTCACTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044504980_1044504987 16 Left 1044504980 8:93006734-93006756 CCCATCTTGGCCAGACTGCCTCT 0: 1
1: 0
2: 5
3: 20
4: 213
Right 1044504987 8:93006773-93006795 CTCCTCCCTCTTCACTGTGTGGG No data
1044504981_1044504987 15 Left 1044504981 8:93006735-93006757 CCATCTTGGCCAGACTGCCTCTT 0: 1
1: 0
2: 2
3: 41
4: 519
Right 1044504987 8:93006773-93006795 CTCCTCCCTCTTCACTGTGTGGG No data
1044504985_1044504987 -2 Left 1044504985 8:93006752-93006774 CCTCTTTAGGCAGGACTTAGACT 0: 1
1: 0
2: 3
3: 26
4: 165
Right 1044504987 8:93006773-93006795 CTCCTCCCTCTTCACTGTGTGGG No data
1044504984_1044504987 6 Left 1044504984 8:93006744-93006766 CCAGACTGCCTCTTTAGGCAGGA 0: 1
1: 21
2: 103
3: 202
4: 518
Right 1044504987 8:93006773-93006795 CTCCTCCCTCTTCACTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044504987 Original CRISPR CTCCTCCCTCTTCACTGTGT GGG Intronic
No off target data available for this crispr