ID: 1044506149

View in Genome Browser
Species Human (GRCh38)
Location 8:93022249-93022271
Sequence GTGGAAGGGGGAGACGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044506141_1044506149 -4 Left 1044506141 8:93022230-93022252 CCACTTCATGCTGATGGAGGTGG No data
Right 1044506149 8:93022249-93022271 GTGGAAGGGGGAGACGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044506149 Original CRISPR GTGGAAGGGGGAGACGGAGG TGG Intergenic
No off target data available for this crispr