ID: 1044514002

View in Genome Browser
Species Human (GRCh38)
Location 8:93117326-93117348
Sequence GGGCTCTAAGCTAGATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044514002_1044514008 18 Left 1044514002 8:93117326-93117348 CCTTCAAATCTAGCTTAGAGCCC No data
Right 1044514008 8:93117367-93117389 CCTGACCACATTCCTTTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044514002 Original CRISPR GGGCTCTAAGCTAGATTTGA AGG (reversed) Intergenic