ID: 1044515266

View in Genome Browser
Species Human (GRCh38)
Location 8:93130287-93130309
Sequence CAGTGTGTTCAGAGTGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044515266_1044515268 20 Left 1044515266 8:93130287-93130309 CCAACTTCACTCTGAACACACTG No data
Right 1044515268 8:93130330-93130352 AATGAAAACCTGAAATTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044515266 Original CRISPR CAGTGTGTTCAGAGTGAAGT TGG (reversed) Intergenic
No off target data available for this crispr