ID: 1044519694 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:93184985-93185007 |
| Sequence | TTTCTGCAAGAATACTACAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1044519694_1044519696 | 12 | Left | 1044519694 | 8:93184985-93185007 | CCTCTGTAGTATTCTTGCAGAAA | No data | ||
| Right | 1044519696 | 8:93185020-93185042 | AATATAATAATGAGTCTATTGGG | No data | ||||
| 1044519694_1044519697 | 30 | Left | 1044519694 | 8:93184985-93185007 | CCTCTGTAGTATTCTTGCAGAAA | No data | ||
| Right | 1044519697 | 8:93185038-93185060 | TTGGGCTAATCCAGAATTGAAGG | No data | ||||
| 1044519694_1044519695 | 11 | Left | 1044519694 | 8:93184985-93185007 | CCTCTGTAGTATTCTTGCAGAAA | No data | ||
| Right | 1044519695 | 8:93185019-93185041 | GAATATAATAATGAGTCTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1044519694 | Original CRISPR | TTTCTGCAAGAATACTACAG AGG (reversed) | Intergenic | ||