ID: 1044519696

View in Genome Browser
Species Human (GRCh38)
Location 8:93185020-93185042
Sequence AATATAATAATGAGTCTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044519694_1044519696 12 Left 1044519694 8:93184985-93185007 CCTCTGTAGTATTCTTGCAGAAA No data
Right 1044519696 8:93185020-93185042 AATATAATAATGAGTCTATTGGG No data
1044519693_1044519696 22 Left 1044519693 8:93184975-93184997 CCAAGAAGTGCCTCTGTAGTATT No data
Right 1044519696 8:93185020-93185042 AATATAATAATGAGTCTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044519696 Original CRISPR AATATAATAATGAGTCTATT GGG Intergenic