ID: 1044519697

View in Genome Browser
Species Human (GRCh38)
Location 8:93185038-93185060
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044519694_1044519697 30 Left 1044519694 8:93184985-93185007 CCTCTGTAGTATTCTTGCAGAAA No data
Right 1044519697 8:93185038-93185060 TTGGGCTAATCCAGAATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044519697 Original CRISPR TTGGGCTAATCCAGAATTGA AGG Intergenic
No off target data available for this crispr