ID: 1044520511

View in Genome Browser
Species Human (GRCh38)
Location 8:93194045-93194067
Sequence CTGACGGACTAGCTCACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044520511_1044520512 -8 Left 1044520511 8:93194045-93194067 CCTACTGTGAGCTAGTCCGTCAG No data
Right 1044520512 8:93194060-93194082 TCCGTCAGCTAGCACATAGCTGG No data
1044520511_1044520515 28 Left 1044520511 8:93194045-93194067 CCTACTGTGAGCTAGTCCGTCAG No data
Right 1044520515 8:93194096-93194118 AAAGGAATAAGAATAACTAAAGG No data
1044520511_1044520514 10 Left 1044520511 8:93194045-93194067 CCTACTGTGAGCTAGTCCGTCAG No data
Right 1044520514 8:93194078-93194100 GCTGGAATAAGAATAACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044520511 Original CRISPR CTGACGGACTAGCTCACAGT AGG (reversed) Intergenic
No off target data available for this crispr