ID: 1044523509

View in Genome Browser
Species Human (GRCh38)
Location 8:93225875-93225897
Sequence GCTGGCTTGAGCCCTTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044523509_1044523513 13 Left 1044523509 8:93225875-93225897 CCAGGCAAAGGGCTCAAGCCAGC No data
Right 1044523513 8:93225911-93225933 GTGTCAGAGAGCCGTCTCAGAGG No data
1044523509_1044523514 16 Left 1044523509 8:93225875-93225897 CCAGGCAAAGGGCTCAAGCCAGC No data
Right 1044523514 8:93225914-93225936 TCAGAGAGCCGTCTCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044523509 Original CRISPR GCTGGCTTGAGCCCTTTGCC TGG (reversed) Intergenic