ID: 1044523511 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:93225897-93225919 |
| Sequence | CTCTGACACTGAAATCTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1044523511_1044523513 | -9 | Left | 1044523511 | 8:93225897-93225919 | CCTTCCAGATTTCAGTGTCAGAG | No data | ||
| Right | 1044523513 | 8:93225911-93225933 | GTGTCAGAGAGCCGTCTCAGAGG | No data | ||||
| 1044523511_1044523514 | -6 | Left | 1044523511 | 8:93225897-93225919 | CCTTCCAGATTTCAGTGTCAGAG | No data | ||
| Right | 1044523514 | 8:93225914-93225936 | TCAGAGAGCCGTCTCAGAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1044523511 | Original CRISPR | CTCTGACACTGAAATCTGGA AGG (reversed) | Intergenic | ||