ID: 1044523511

View in Genome Browser
Species Human (GRCh38)
Location 8:93225897-93225919
Sequence CTCTGACACTGAAATCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044523511_1044523513 -9 Left 1044523511 8:93225897-93225919 CCTTCCAGATTTCAGTGTCAGAG No data
Right 1044523513 8:93225911-93225933 GTGTCAGAGAGCCGTCTCAGAGG No data
1044523511_1044523514 -6 Left 1044523511 8:93225897-93225919 CCTTCCAGATTTCAGTGTCAGAG No data
Right 1044523514 8:93225914-93225936 TCAGAGAGCCGTCTCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044523511 Original CRISPR CTCTGACACTGAAATCTGGA AGG (reversed) Intergenic