ID: 1044523513

View in Genome Browser
Species Human (GRCh38)
Location 8:93225911-93225933
Sequence GTGTCAGAGAGCCGTCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044523511_1044523513 -9 Left 1044523511 8:93225897-93225919 CCTTCCAGATTTCAGTGTCAGAG No data
Right 1044523513 8:93225911-93225933 GTGTCAGAGAGCCGTCTCAGAGG No data
1044523509_1044523513 13 Left 1044523509 8:93225875-93225897 CCAGGCAAAGGGCTCAAGCCAGC No data
Right 1044523513 8:93225911-93225933 GTGTCAGAGAGCCGTCTCAGAGG No data
1044523510_1044523513 -5 Left 1044523510 8:93225893-93225915 CCAGCCTTCCAGATTTCAGTGTC No data
Right 1044523513 8:93225911-93225933 GTGTCAGAGAGCCGTCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044523513 Original CRISPR GTGTCAGAGAGCCGTCTCAG AGG Intergenic