ID: 1044525052

View in Genome Browser
Species Human (GRCh38)
Location 8:93242027-93242049
Sequence ACAATCTTGGCTGCCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044525052_1044525061 24 Left 1044525052 8:93242027-93242049 CCTTCCAGGGCAGCCAAGATTGT No data
Right 1044525061 8:93242074-93242096 TGTTTGGCTGCGCTGCACCTGGG No data
1044525052_1044525060 23 Left 1044525052 8:93242027-93242049 CCTTCCAGGGCAGCCAAGATTGT No data
Right 1044525060 8:93242073-93242095 CTGTTTGGCTGCGCTGCACCTGG No data
1044525052_1044525056 -10 Left 1044525052 8:93242027-93242049 CCTTCCAGGGCAGCCAAGATTGT No data
Right 1044525056 8:93242040-93242062 CCAAGATTGTAGAGATGCCTGGG No data
1044525052_1044525064 27 Left 1044525052 8:93242027-93242049 CCTTCCAGGGCAGCCAAGATTGT No data
Right 1044525064 8:93242077-93242099 TTGGCTGCGCTGCACCTGGGGGG No data
1044525052_1044525062 25 Left 1044525052 8:93242027-93242049 CCTTCCAGGGCAGCCAAGATTGT No data
Right 1044525062 8:93242075-93242097 GTTTGGCTGCGCTGCACCTGGGG No data
1044525052_1044525063 26 Left 1044525052 8:93242027-93242049 CCTTCCAGGGCAGCCAAGATTGT No data
Right 1044525063 8:93242076-93242098 TTTGGCTGCGCTGCACCTGGGGG No data
1044525052_1044525058 8 Left 1044525052 8:93242027-93242049 CCTTCCAGGGCAGCCAAGATTGT No data
Right 1044525058 8:93242058-93242080 CTGGGTCCACAGCAGCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044525052 Original CRISPR ACAATCTTGGCTGCCCTGGA AGG (reversed) Intergenic
No off target data available for this crispr