ID: 1044525053

View in Genome Browser
Species Human (GRCh38)
Location 8:93242031-93242053
Sequence CTCTACAATCTTGGCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044525053_1044525060 19 Left 1044525053 8:93242031-93242053 CCAGGGCAGCCAAGATTGTAGAG No data
Right 1044525060 8:93242073-93242095 CTGTTTGGCTGCGCTGCACCTGG No data
1044525053_1044525061 20 Left 1044525053 8:93242031-93242053 CCAGGGCAGCCAAGATTGTAGAG No data
Right 1044525061 8:93242074-93242096 TGTTTGGCTGCGCTGCACCTGGG No data
1044525053_1044525062 21 Left 1044525053 8:93242031-93242053 CCAGGGCAGCCAAGATTGTAGAG No data
Right 1044525062 8:93242075-93242097 GTTTGGCTGCGCTGCACCTGGGG No data
1044525053_1044525063 22 Left 1044525053 8:93242031-93242053 CCAGGGCAGCCAAGATTGTAGAG No data
Right 1044525063 8:93242076-93242098 TTTGGCTGCGCTGCACCTGGGGG No data
1044525053_1044525065 29 Left 1044525053 8:93242031-93242053 CCAGGGCAGCCAAGATTGTAGAG No data
Right 1044525065 8:93242083-93242105 GCGCTGCACCTGGGGGGTGCAGG No data
1044525053_1044525064 23 Left 1044525053 8:93242031-93242053 CCAGGGCAGCCAAGATTGTAGAG No data
Right 1044525064 8:93242077-93242099 TTGGCTGCGCTGCACCTGGGGGG No data
1044525053_1044525066 30 Left 1044525053 8:93242031-93242053 CCAGGGCAGCCAAGATTGTAGAG No data
Right 1044525066 8:93242084-93242106 CGCTGCACCTGGGGGGTGCAGGG No data
1044525053_1044525058 4 Left 1044525053 8:93242031-93242053 CCAGGGCAGCCAAGATTGTAGAG No data
Right 1044525058 8:93242058-93242080 CTGGGTCCACAGCAGCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044525053 Original CRISPR CTCTACAATCTTGGCTGCCC TGG (reversed) Intergenic
No off target data available for this crispr