ID: 1044525057

View in Genome Browser
Species Human (GRCh38)
Location 8:93242057-93242079
Sequence CAAACAGCTGCTGTGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044525057_1044525068 22 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525068 8:93242102-93242124 CAGGGCTTCTACCTGCTTCGTGG No data
1044525057_1044525061 -6 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525061 8:93242074-93242096 TGTTTGGCTGCGCTGCACCTGGG No data
1044525057_1044525063 -4 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525063 8:93242076-93242098 TTTGGCTGCGCTGCACCTGGGGG No data
1044525057_1044525069 28 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525069 8:93242108-93242130 TTCTACCTGCTTCGTGGAGTAGG No data
1044525057_1044525060 -7 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525060 8:93242073-93242095 CTGTTTGGCTGCGCTGCACCTGG No data
1044525057_1044525062 -5 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525062 8:93242075-93242097 GTTTGGCTGCGCTGCACCTGGGG No data
1044525057_1044525064 -3 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525064 8:93242077-93242099 TTGGCTGCGCTGCACCTGGGGGG No data
1044525057_1044525066 4 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525066 8:93242084-93242106 CGCTGCACCTGGGGGGTGCAGGG No data
1044525057_1044525065 3 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525065 8:93242083-93242105 GCGCTGCACCTGGGGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044525057 Original CRISPR CAAACAGCTGCTGTGGACCC AGG (reversed) Intergenic
No off target data available for this crispr