ID: 1044525059

View in Genome Browser
Species Human (GRCh38)
Location 8:93242064-93242086
Sequence GCGCAGCCAAACAGCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044525059_1044525068 15 Left 1044525059 8:93242064-93242086 CCACAGCAGCTGTTTGGCTGCGC No data
Right 1044525068 8:93242102-93242124 CAGGGCTTCTACCTGCTTCGTGG No data
1044525059_1044525069 21 Left 1044525059 8:93242064-93242086 CCACAGCAGCTGTTTGGCTGCGC No data
Right 1044525069 8:93242108-93242130 TTCTACCTGCTTCGTGGAGTAGG No data
1044525059_1044525070 24 Left 1044525059 8:93242064-93242086 CCACAGCAGCTGTTTGGCTGCGC No data
Right 1044525070 8:93242111-93242133 TACCTGCTTCGTGGAGTAGGAGG No data
1044525059_1044525073 30 Left 1044525059 8:93242064-93242086 CCACAGCAGCTGTTTGGCTGCGC No data
Right 1044525073 8:93242117-93242139 CTTCGTGGAGTAGGAGGCCTGGG No data
1044525059_1044525065 -4 Left 1044525059 8:93242064-93242086 CCACAGCAGCTGTTTGGCTGCGC No data
Right 1044525065 8:93242083-93242105 GCGCTGCACCTGGGGGGTGCAGG No data
1044525059_1044525064 -10 Left 1044525059 8:93242064-93242086 CCACAGCAGCTGTTTGGCTGCGC No data
Right 1044525064 8:93242077-93242099 TTGGCTGCGCTGCACCTGGGGGG No data
1044525059_1044525072 29 Left 1044525059 8:93242064-93242086 CCACAGCAGCTGTTTGGCTGCGC No data
Right 1044525072 8:93242116-93242138 GCTTCGTGGAGTAGGAGGCCTGG No data
1044525059_1044525066 -3 Left 1044525059 8:93242064-93242086 CCACAGCAGCTGTTTGGCTGCGC No data
Right 1044525066 8:93242084-93242106 CGCTGCACCTGGGGGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044525059 Original CRISPR GCGCAGCCAAACAGCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr