ID: 1044525060

View in Genome Browser
Species Human (GRCh38)
Location 8:93242073-93242095
Sequence CTGTTTGGCTGCGCTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044525055_1044525060 10 Left 1044525055 8:93242040-93242062 CCAAGATTGTAGAGATGCCTGGG No data
Right 1044525060 8:93242073-93242095 CTGTTTGGCTGCGCTGCACCTGG No data
1044525052_1044525060 23 Left 1044525052 8:93242027-93242049 CCTTCCAGGGCAGCCAAGATTGT No data
Right 1044525060 8:93242073-93242095 CTGTTTGGCTGCGCTGCACCTGG No data
1044525057_1044525060 -7 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525060 8:93242073-93242095 CTGTTTGGCTGCGCTGCACCTGG No data
1044525053_1044525060 19 Left 1044525053 8:93242031-93242053 CCAGGGCAGCCAAGATTGTAGAG No data
Right 1044525060 8:93242073-93242095 CTGTTTGGCTGCGCTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044525060 Original CRISPR CTGTTTGGCTGCGCTGCACC TGG Intergenic
No off target data available for this crispr