ID: 1044525064

View in Genome Browser
Species Human (GRCh38)
Location 8:93242077-93242099
Sequence TTGGCTGCGCTGCACCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044525052_1044525064 27 Left 1044525052 8:93242027-93242049 CCTTCCAGGGCAGCCAAGATTGT No data
Right 1044525064 8:93242077-93242099 TTGGCTGCGCTGCACCTGGGGGG No data
1044525053_1044525064 23 Left 1044525053 8:93242031-93242053 CCAGGGCAGCCAAGATTGTAGAG No data
Right 1044525064 8:93242077-93242099 TTGGCTGCGCTGCACCTGGGGGG No data
1044525059_1044525064 -10 Left 1044525059 8:93242064-93242086 CCACAGCAGCTGTTTGGCTGCGC No data
Right 1044525064 8:93242077-93242099 TTGGCTGCGCTGCACCTGGGGGG No data
1044525057_1044525064 -3 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525064 8:93242077-93242099 TTGGCTGCGCTGCACCTGGGGGG No data
1044525055_1044525064 14 Left 1044525055 8:93242040-93242062 CCAAGATTGTAGAGATGCCTGGG No data
Right 1044525064 8:93242077-93242099 TTGGCTGCGCTGCACCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044525064 Original CRISPR TTGGCTGCGCTGCACCTGGG GGG Intergenic
No off target data available for this crispr