ID: 1044525067

View in Genome Browser
Species Human (GRCh38)
Location 8:93242091-93242113
Sequence GTAGAAGCCCTGCACCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044525067_1044525078 25 Left 1044525067 8:93242091-93242113 CCTGGGGGGTGCAGGGCTTCTAC No data
Right 1044525078 8:93242139-93242161 GTCTGCAGCCACGGTTTGGGTGG No data
1044525067_1044525072 2 Left 1044525067 8:93242091-93242113 CCTGGGGGGTGCAGGGCTTCTAC No data
Right 1044525072 8:93242116-93242138 GCTTCGTGGAGTAGGAGGCCTGG No data
1044525067_1044525069 -6 Left 1044525067 8:93242091-93242113 CCTGGGGGGTGCAGGGCTTCTAC No data
Right 1044525069 8:93242108-93242130 TTCTACCTGCTTCGTGGAGTAGG No data
1044525067_1044525073 3 Left 1044525067 8:93242091-93242113 CCTGGGGGGTGCAGGGCTTCTAC No data
Right 1044525073 8:93242117-93242139 CTTCGTGGAGTAGGAGGCCTGGG No data
1044525067_1044525070 -3 Left 1044525067 8:93242091-93242113 CCTGGGGGGTGCAGGGCTTCTAC No data
Right 1044525070 8:93242111-93242133 TACCTGCTTCGTGGAGTAGGAGG No data
1044525067_1044525077 22 Left 1044525067 8:93242091-93242113 CCTGGGGGGTGCAGGGCTTCTAC No data
Right 1044525077 8:93242136-93242158 TGGGTCTGCAGCCACGGTTTGGG 0: 4
1: 23
2: 52
3: 152
4: 248
1044525067_1044525076 21 Left 1044525067 8:93242091-93242113 CCTGGGGGGTGCAGGGCTTCTAC No data
Right 1044525076 8:93242135-93242157 CTGGGTCTGCAGCCACGGTTTGG 0: 4
1: 27
2: 64
3: 185
4: 346
1044525067_1044525074 16 Left 1044525067 8:93242091-93242113 CCTGGGGGGTGCAGGGCTTCTAC No data
Right 1044525074 8:93242130-93242152 GAGGCCTGGGTCTGCAGCCACGG 0: 8
1: 28
2: 78
3: 170
4: 648

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044525067 Original CRISPR GTAGAAGCCCTGCACCCCCC AGG (reversed) Intergenic
No off target data available for this crispr