ID: 1044525068

View in Genome Browser
Species Human (GRCh38)
Location 8:93242102-93242124
Sequence CAGGGCTTCTACCTGCTTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044525059_1044525068 15 Left 1044525059 8:93242064-93242086 CCACAGCAGCTGTTTGGCTGCGC No data
Right 1044525068 8:93242102-93242124 CAGGGCTTCTACCTGCTTCGTGG No data
1044525057_1044525068 22 Left 1044525057 8:93242057-93242079 CCTGGGTCCACAGCAGCTGTTTG No data
Right 1044525068 8:93242102-93242124 CAGGGCTTCTACCTGCTTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044525068 Original CRISPR CAGGGCTTCTACCTGCTTCG TGG Intergenic
No off target data available for this crispr