ID: 1044529872

View in Genome Browser
Species Human (GRCh38)
Location 8:93294797-93294819
Sequence CCTTATTTGCAGGAGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044529868_1044529872 8 Left 1044529868 8:93294766-93294788 CCTTGATAAAGAGGGTTGTTTGG No data
Right 1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG No data
1044529865_1044529872 22 Left 1044529865 8:93294752-93294774 CCTTCACTTGATCTCCTTGATAA No data
Right 1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044529872 Original CRISPR CCTTATTTGCAGGAGCAGCA TGG Intergenic
No off target data available for this crispr