ID: 1044533356

View in Genome Browser
Species Human (GRCh38)
Location 8:93333004-93333026
Sequence AGGAAGAAACAAAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044533353_1044533356 1 Left 1044533353 8:93332980-93333002 CCAAGAAAAGGCACAAGGAACTC No data
Right 1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG No data
1044533350_1044533356 14 Left 1044533350 8:93332967-93332989 CCTAGAAAGAAGACCAAGAAAAG No data
Right 1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044533356 Original CRISPR AGGAAGAAACAAAATGAGGA AGG Intergenic
No off target data available for this crispr