ID: 1044534385

View in Genome Browser
Species Human (GRCh38)
Location 8:93342791-93342813
Sequence GCTTTTCTGCAGAAGATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044534385_1044534386 13 Left 1044534385 8:93342791-93342813 CCACTCATCTTCTGCAGAAAAGC No data
Right 1044534386 8:93342827-93342849 CATCAGAGAGCAGCACTCATTGG No data
1044534385_1044534387 27 Left 1044534385 8:93342791-93342813 CCACTCATCTTCTGCAGAAAAGC No data
Right 1044534387 8:93342841-93342863 ACTCATTGGAAGTAGCTCCTCGG No data
1044534385_1044534388 28 Left 1044534385 8:93342791-93342813 CCACTCATCTTCTGCAGAAAAGC No data
Right 1044534388 8:93342842-93342864 CTCATTGGAAGTAGCTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044534385 Original CRISPR GCTTTTCTGCAGAAGATGAG TGG (reversed) Intergenic
No off target data available for this crispr