ID: 1044534386

View in Genome Browser
Species Human (GRCh38)
Location 8:93342827-93342849
Sequence CATCAGAGAGCAGCACTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044534385_1044534386 13 Left 1044534385 8:93342791-93342813 CCACTCATCTTCTGCAGAAAAGC No data
Right 1044534386 8:93342827-93342849 CATCAGAGAGCAGCACTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044534386 Original CRISPR CATCAGAGAGCAGCACTCAT TGG Intergenic
No off target data available for this crispr