ID: 1044534387

View in Genome Browser
Species Human (GRCh38)
Location 8:93342841-93342863
Sequence ACTCATTGGAAGTAGCTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044534385_1044534387 27 Left 1044534385 8:93342791-93342813 CCACTCATCTTCTGCAGAAAAGC No data
Right 1044534387 8:93342841-93342863 ACTCATTGGAAGTAGCTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044534387 Original CRISPR ACTCATTGGAAGTAGCTCCT CGG Intergenic
No off target data available for this crispr