ID: 1044536773

View in Genome Browser
Species Human (GRCh38)
Location 8:93365924-93365946
Sequence CAGGGATATTAGCAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044536768_1044536773 -4 Left 1044536768 8:93365905-93365927 CCAGATCTATGGGACAAACCAGG No data
Right 1044536773 8:93365924-93365946 CAGGGATATTAGCAAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044536773 Original CRISPR CAGGGATATTAGCAAGAGGA TGG Intergenic
No off target data available for this crispr