ID: 1044542386

View in Genome Browser
Species Human (GRCh38)
Location 8:93422367-93422389
Sequence CTTAGAATATGTCAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044542378_1044542386 19 Left 1044542378 8:93422325-93422347 CCTTTTCAGACTCATGTGTCCAC No data
Right 1044542386 8:93422367-93422389 CTTAGAATATGTCAGGAAGTGGG No data
1044542375_1044542386 28 Left 1044542375 8:93422316-93422338 CCCCTGTGACCTTTTCAGACTCA No data
Right 1044542386 8:93422367-93422389 CTTAGAATATGTCAGGAAGTGGG No data
1044542377_1044542386 26 Left 1044542377 8:93422318-93422340 CCTGTGACCTTTTCAGACTCATG No data
Right 1044542386 8:93422367-93422389 CTTAGAATATGTCAGGAAGTGGG No data
1044542381_1044542386 -8 Left 1044542381 8:93422352-93422374 CCACATTCCACATGCCTTAGAAT No data
Right 1044542386 8:93422367-93422389 CTTAGAATATGTCAGGAAGTGGG No data
1044542379_1044542386 0 Left 1044542379 8:93422344-93422366 CCACTCTCCCACATTCCACATGC No data
Right 1044542386 8:93422367-93422389 CTTAGAATATGTCAGGAAGTGGG No data
1044542376_1044542386 27 Left 1044542376 8:93422317-93422339 CCCTGTGACCTTTTCAGACTCAT No data
Right 1044542386 8:93422367-93422389 CTTAGAATATGTCAGGAAGTGGG No data
1044542380_1044542386 -7 Left 1044542380 8:93422351-93422373 CCCACATTCCACATGCCTTAGAA No data
Right 1044542386 8:93422367-93422389 CTTAGAATATGTCAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044542386 Original CRISPR CTTAGAATATGTCAGGAAGT GGG Intergenic
No off target data available for this crispr