ID: 1044543466

View in Genome Browser
Species Human (GRCh38)
Location 8:93433323-93433345
Sequence CATGCCCCAAATCTACTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044543466_1044543468 23 Left 1044543466 8:93433323-93433345 CCTGACAGTAGATTTGGGGCATG No data
Right 1044543468 8:93433369-93433391 CTTTTTTAAAAAATGCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044543466 Original CRISPR CATGCCCCAAATCTACTGTC AGG (reversed) Intergenic
No off target data available for this crispr