ID: 1044547073

View in Genome Browser
Species Human (GRCh38)
Location 8:93471929-93471951
Sequence ACTTGATGGTGGGCAGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044547073_1044547085 27 Left 1044547073 8:93471929-93471951 CCCAGTCCTGCCCACCATCAAGT No data
Right 1044547085 8:93471979-93472001 GGTAGCCAATGTTGGAGTGTGGG No data
1044547073_1044547081 19 Left 1044547073 8:93471929-93471951 CCCAGTCCTGCCCACCATCAAGT No data
Right 1044547081 8:93471971-93471993 ACTTCCCTGGTAGCCAATGTTGG No data
1044547073_1044547084 26 Left 1044547073 8:93471929-93471951 CCCAGTCCTGCCCACCATCAAGT No data
Right 1044547084 8:93471978-93472000 TGGTAGCCAATGTTGGAGTGTGG No data
1044547073_1044547086 28 Left 1044547073 8:93471929-93471951 CCCAGTCCTGCCCACCATCAAGT No data
Right 1044547086 8:93471980-93472002 GTAGCCAATGTTGGAGTGTGGGG No data
1044547073_1044547080 6 Left 1044547073 8:93471929-93471951 CCCAGTCCTGCCCACCATCAAGT No data
Right 1044547080 8:93471958-93471980 GTTGGCAATTTAGACTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044547073 Original CRISPR ACTTGATGGTGGGCAGGACT GGG (reversed) Intergenic
No off target data available for this crispr