ID: 1044553825

View in Genome Browser
Species Human (GRCh38)
Location 8:93540699-93540721
Sequence TCCAGGCTTTTGAGGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044553825_1044553832 23 Left 1044553825 8:93540699-93540721 CCAACTGCCCTCAAAAGCCTGGA No data
Right 1044553832 8:93540745-93540767 GAAAGTCTTTATAAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044553825 Original CRISPR TCCAGGCTTTTGAGGGCAGT TGG (reversed) Intergenic
No off target data available for this crispr