ID: 1044556898

View in Genome Browser
Species Human (GRCh38)
Location 8:93572505-93572527
Sequence AAACTCCCAACTGTGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044556896_1044556898 7 Left 1044556896 8:93572475-93572497 CCTTTTACAATCTCTGAGAACAC No data
Right 1044556898 8:93572505-93572527 AAACTCCCAACTGTGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044556898 Original CRISPR AAACTCCCAACTGTGAAGCT AGG Intergenic
No off target data available for this crispr