ID: 1044557298

View in Genome Browser
Species Human (GRCh38)
Location 8:93577425-93577447
Sequence CTGTACAAATGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044557292_1044557298 12 Left 1044557292 8:93577390-93577412 CCTGACTAGGAGCTCCTGCTTTC No data
Right 1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG No data
1044557291_1044557298 13 Left 1044557291 8:93577389-93577411 CCCTGACTAGGAGCTCCTGCTTT No data
Right 1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG No data
1044557294_1044557298 -2 Left 1044557294 8:93577404-93577426 CCTGCTTTCAAAAATGGATGCCT No data
Right 1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044557298 Original CRISPR CTGTACAAATGGAGAGAAGT GGG Intergenic
No off target data available for this crispr