ID: 1044557696

View in Genome Browser
Species Human (GRCh38)
Location 8:93582053-93582075
Sequence GACTATCCATTGGCCCACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044557696_1044557699 -4 Left 1044557696 8:93582053-93582075 CCCACGTGGGCCAATGGATAGTC No data
Right 1044557699 8:93582072-93582094 AGTCAAGTCATAAATGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044557696 Original CRISPR GACTATCCATTGGCCCACGT GGG (reversed) Intergenic
No off target data available for this crispr