ID: 1044557699

View in Genome Browser
Species Human (GRCh38)
Location 8:93582072-93582094
Sequence AGTCAAGTCATAAATGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044557696_1044557699 -4 Left 1044557696 8:93582053-93582075 CCCACGTGGGCCAATGGATAGTC No data
Right 1044557699 8:93582072-93582094 AGTCAAGTCATAAATGCAGTAGG No data
1044557697_1044557699 -5 Left 1044557697 8:93582054-93582076 CCACGTGGGCCAATGGATAGTCA No data
Right 1044557699 8:93582072-93582094 AGTCAAGTCATAAATGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044557699 Original CRISPR AGTCAAGTCATAAATGCAGT AGG Intergenic
No off target data available for this crispr