ID: 1044559347

View in Genome Browser
Species Human (GRCh38)
Location 8:93597187-93597209
Sequence AGGGAGAAGGAAGATGTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044559347_1044559353 21 Left 1044559347 8:93597187-93597209 CCTGCGACATCTTCCTTCTCCCT No data
Right 1044559353 8:93597231-93597253 AGTGTCAAAGACCTTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044559347 Original CRISPR AGGGAGAAGGAAGATGTCGC AGG (reversed) Intergenic
No off target data available for this crispr