ID: 1044559353

View in Genome Browser
Species Human (GRCh38)
Location 8:93597231-93597253
Sequence AGTGTCAAAGACCTTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044559351_1044559353 -6 Left 1044559351 8:93597214-93597236 CCAGCTCCAATGCTTTGAGTGTC No data
Right 1044559353 8:93597231-93597253 AGTGTCAAAGACCTTACTCCAGG No data
1044559349_1044559353 2 Left 1044559349 8:93597206-93597228 CCCTTAAGCCAGCTCCAATGCTT No data
Right 1044559353 8:93597231-93597253 AGTGTCAAAGACCTTACTCCAGG No data
1044559346_1044559353 24 Left 1044559346 8:93597184-93597206 CCACCTGCGACATCTTCCTTCTC No data
Right 1044559353 8:93597231-93597253 AGTGTCAAAGACCTTACTCCAGG No data
1044559348_1044559353 8 Left 1044559348 8:93597200-93597222 CCTTCTCCCTTAAGCCAGCTCCA No data
Right 1044559353 8:93597231-93597253 AGTGTCAAAGACCTTACTCCAGG No data
1044559347_1044559353 21 Left 1044559347 8:93597187-93597209 CCTGCGACATCTTCCTTCTCCCT No data
Right 1044559353 8:93597231-93597253 AGTGTCAAAGACCTTACTCCAGG No data
1044559350_1044559353 1 Left 1044559350 8:93597207-93597229 CCTTAAGCCAGCTCCAATGCTTT No data
Right 1044559353 8:93597231-93597253 AGTGTCAAAGACCTTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044559353 Original CRISPR AGTGTCAAAGACCTTACTCC AGG Intergenic
No off target data available for this crispr