ID: 1044561921

View in Genome Browser
Species Human (GRCh38)
Location 8:93620702-93620724
Sequence GTCTGCAGTGCTGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044561914_1044561921 27 Left 1044561914 8:93620652-93620674 CCACCTCTACAAATAAATAAATA No data
Right 1044561921 8:93620702-93620724 GTCTGCAGTGCTGAGGTGGAAGG No data
1044561915_1044561921 24 Left 1044561915 8:93620655-93620677 CCTCTACAAATAAATAAATAAAT No data
Right 1044561921 8:93620702-93620724 GTCTGCAGTGCTGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044561921 Original CRISPR GTCTGCAGTGCTGAGGTGGA AGG Intergenic
No off target data available for this crispr