ID: 1044562015

View in Genome Browser
Species Human (GRCh38)
Location 8:93621655-93621677
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044562015_1044562017 4 Left 1044562015 8:93621655-93621677 CCTTCATTTACATCAGTGTCTGT No data
Right 1044562017 8:93621682-93621704 ATCTATTGAGACTCTGCCATGGG No data
1044562015_1044562016 3 Left 1044562015 8:93621655-93621677 CCTTCATTTACATCAGTGTCTGT No data
Right 1044562016 8:93621681-93621703 AATCTATTGAGACTCTGCCATGG No data
1044562015_1044562019 26 Left 1044562015 8:93621655-93621677 CCTTCATTTACATCAGTGTCTGT No data
Right 1044562019 8:93621704-93621726 GTATATCCTGCAGAAGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044562015 Original CRISPR ACAGACACTGATGTAAATGA AGG (reversed) Intergenic
No off target data available for this crispr