ID: 1044562016

View in Genome Browser
Species Human (GRCh38)
Location 8:93621681-93621703
Sequence AATCTATTGAGACTCTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044562015_1044562016 3 Left 1044562015 8:93621655-93621677 CCTTCATTTACATCAGTGTCTGT No data
Right 1044562016 8:93621681-93621703 AATCTATTGAGACTCTGCCATGG No data
1044562014_1044562016 6 Left 1044562014 8:93621652-93621674 CCTCCTTCATTTACATCAGTGTC No data
Right 1044562016 8:93621681-93621703 AATCTATTGAGACTCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044562016 Original CRISPR AATCTATTGAGACTCTGCCA TGG Intergenic
No off target data available for this crispr