ID: 1044569404

View in Genome Browser
Species Human (GRCh38)
Location 8:93700575-93700597
Sequence CAGCGCGCGCCCAGGCGCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044569398_1044569404 -3 Left 1044569398 8:93700555-93700577 CCCGGCGGCTGCTTGCGCCCCAG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1044569404 8:93700575-93700597 CAGCGCGCGCCCAGGCGCCTTGG 0: 1
1: 0
2: 2
3: 10
4: 114
1044569394_1044569404 29 Left 1044569394 8:93700523-93700545 CCGCGGCGGCGCGAGGGGCGGGC 0: 1
1: 0
2: 6
3: 50
4: 316
Right 1044569404 8:93700575-93700597 CAGCGCGCGCCCAGGCGCCTTGG 0: 1
1: 0
2: 2
3: 10
4: 114
1044569399_1044569404 -4 Left 1044569399 8:93700556-93700578 CCGGCGGCTGCTTGCGCCCCAGC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 1044569404 8:93700575-93700597 CAGCGCGCGCCCAGGCGCCTTGG 0: 1
1: 0
2: 2
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044569404 Original CRISPR CAGCGCGCGCCCAGGCGCCT TGG Exonic
900148229 1:1167463-1167485 CAGCTCCCGCCCAGGCGCTGTGG - Intergenic
902830046 1:19006651-19006673 CAGCCCGGGACCAGGCCCCTGGG - Intergenic
903765572 1:25732117-25732139 CAGAGGGTGCCCAGGCTCCTAGG + Intronic
906960293 1:50415893-50415915 CAGCGTGCCCCCAAGCGCCTTGG - Intergenic
912492674 1:110070636-110070658 CAGCGCGAGCCCCGGAGCCCCGG - Exonic
912520443 1:110241034-110241056 CATCCCGCCCCCAGGCGCCCTGG - Intronic
922416379 1:225427066-225427088 CAGCGCGAGGCGCGGCGCCTGGG - Intronic
924926868 1:248692052-248692074 GAGCGCGGGCCCGGCCGCCTGGG + Intergenic
1062774797 10:135797-135819 CGGCCCGCGCCCACTCGCCTTGG + Intronic
1067161188 10:43826164-43826186 GAGCGCGAGCCCGGGAGCCTCGG - Intergenic
1067295896 10:44975100-44975122 CAGGGGGCGCCCCGGAGCCTCGG - Intronic
1070954238 10:80454142-80454164 CAGGGCGGGCCCAGGCGCCCGGG + Intergenic
1074773000 10:116745348-116745370 CAGGGCACGCCCAGACTCCTGGG + Intergenic
1075612362 10:123864043-123864065 CAGCCAGAGCCCAGGCTCCTGGG - Intronic
1076554115 10:131311231-131311253 CAGGGCGCGCCCAGGAGCAGGGG + Intronic
1077371315 11:2182850-2182872 CAGCATGGGCCCAGGCGGCTCGG + Intergenic
1077516696 11:3006611-3006633 CAGCGGGCAGCCAGGCCCCTAGG + Intronic
1079035026 11:17013869-17013891 CAGCGCGCGCCAACGAGCCCGGG + Intronic
1080836425 11:35944539-35944561 CCGCGCGCGACCAGGCGTCTGGG - Intronic
1082023278 11:47552755-47552777 CAGCGCGTGCCCCCGCGCCCAGG - Intronic
1084620911 11:70270071-70270093 CAGCGTGGGCCCGGGCGACTCGG - Intergenic
1087118111 11:94544986-94545008 CAGCGCTGGCCCGGGGGCCTGGG - Exonic
1090271613 11:125389909-125389931 CAGAGTGGGCCCAGGGGCCTGGG - Intronic
1090635550 11:128688556-128688578 CACCGCAGGCCCAGGCGCCCAGG + Intronic
1090818140 11:130315929-130315951 CCGCCCGCCCCCAGGCACCTGGG - Intergenic
1092659526 12:10723125-10723147 CTGCTCTCGCTCAGGCGCCTCGG + Exonic
1097193175 12:57229960-57229982 CCACGCGCGCCCAGGGGTCTTGG - Intronic
1105407229 13:20142573-20142595 CAGGGCGTGACCAGCCGCCTCGG - Exonic
1108618555 13:52159348-52159370 CACCGCGCGCCCAGACCCCAAGG + Intronic
1112824543 13:103376986-103377008 CACAGAGCGCCCAGGAGCCTGGG + Intergenic
1116845497 14:49861658-49861680 AAGAACGCGCCCAGCCGCCTGGG - Intergenic
1119357511 14:74019307-74019329 CCCCGCGCGCCGCGGCGCCTGGG + Exonic
1119421292 14:74509375-74509397 CAGCGCTCGCCCGGGGACCTAGG + Intronic
1122204990 14:100143826-100143848 CAGAGCACGCACAGGAGCCTGGG + Exonic
1122557936 14:102591795-102591817 CAGCGGCCACCCAGGCGGCTTGG + Intergenic
1122836672 14:104434052-104434074 CAGAGCGGGCTCAGGCGCCCCGG + Intergenic
1122975054 14:105167629-105167651 CCGCGCGCGCCCAGGCGGGGCGG - Intronic
1202899776 14_GL000194v1_random:28356-28378 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1124382528 15:29178527-29178549 TAGCGCTCGCCCAGGCCCCAGGG - Intronic
1130115418 15:81001385-81001407 CAGAGCGCGGCCCGGCGCCGCGG - Exonic
1130151215 15:81313169-81313191 CTGCGTGCTCCCAGGCTCCTTGG + Exonic
1131257633 15:90872261-90872283 CAGCGGGGGCACAGGGGCCTCGG - Intronic
1132186918 15:99808240-99808262 CAGCGCGCGGCCAGGCCCCGGGG - Intergenic
1132428771 15:101744481-101744503 CAGCGCGCGGCCAGGCCCCGGGG + Exonic
1139264870 16:65629242-65629264 TAGCACGCTCCCAGGCCCCTAGG + Intergenic
1139775784 16:69316384-69316406 CAGCGTCCGCCCAGGAACCTGGG + Intronic
1141659087 16:85431996-85432018 CAGCACTCGCCCAGGCGGCGAGG - Intergenic
1142263973 16:89055143-89055165 CAGGACGCGCCCAGGCACCCGGG - Intergenic
1142980318 17:3667819-3667841 CAGAGGGCGGCCAGGGGCCTAGG + Intronic
1143483486 17:7239742-7239764 AAGTGCGCGCGCAGGCCCCTGGG + Intergenic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1144250264 17:13409257-13409279 CAGCTCGAGCCCATGCCCCTAGG + Intergenic
1144488113 17:15684314-15684336 AAGTGCGCGCCGAGGCTCCTGGG + Intergenic
1144577581 17:16438810-16438832 CAGCCCTCGCGCAGGCGCCCTGG + Intergenic
1144912902 17:18697973-18697995 AAGTGCGCGCCGAGGCTCCTGGG - Intergenic
1145276785 17:21436441-21436463 AAGAGGGCGCCCAGGAGCCTGGG - Intergenic
1145314621 17:21722334-21722356 AAGAGGGCGCCCAGGAGCCTGGG - Intergenic
1145713068 17:26994271-26994293 AAGGGGGCGCCCAGGAGCCTGGG - Intergenic
1148188529 17:45662099-45662121 AAGGGAGTGCCCAGGCGCCTGGG + Intergenic
1148591115 17:48817279-48817301 CACCGCGCACCCGGGCGCCAGGG + Intergenic
1151964964 17:77426371-77426393 CAGCGTGAGCCCAGGAGCCCCGG + Intronic
1152467594 17:80474860-80474882 CAGCGCTCATCCAGGCGCCCTGG + Intronic
1152544089 17:80992104-80992126 CAGCGCGCAGCCGGGCCCCTCGG + Intronic
1153275182 18:3360861-3360883 AAGCACGCGCTCAGACGCCTTGG - Intergenic
1153997555 18:10454911-10454933 GAGCGCGCGCCCAGTTGCCCGGG + Exonic
1159003364 18:62992227-62992249 CTGGGCGCGCCCAGGCGCCCTGG + Intergenic
1160166990 18:76522452-76522474 AAACGCGCGCCTAGGAGCCTGGG + Intergenic
1160453403 18:78979974-78979996 CAGCGCGCGCCCCGGTCCCGAGG + Intergenic
1160577333 18:79864104-79864126 CGGCGCGCGCCCTGGGACCTCGG + Exonic
1161703085 19:5805353-5805375 CACCGCGGGCCCAGGCGGCCCGG + Intergenic
1161846902 19:6716978-6717000 CAGCCCGTGCCAAGGCGCCAAGG + Intronic
1162054217 19:8053088-8053110 CAGCGGGGGCCCAGGCTCCCAGG - Exonic
1162954347 19:14090112-14090134 CGGCGCGCGTCCAGCCGCCCCGG - Exonic
1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG + Exonic
1162979285 19:14228279-14228301 CAGCGCGCTCACAGCCGCCGGGG + Intergenic
1163801473 19:19368320-19368342 CAGCGCGTGCCCAGGGGGCTGGG + Intergenic
932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG + Intronic
937156605 2:119724418-119724440 CAGCTCCCCACCAGGCGCCTGGG - Intergenic
938547975 2:132352664-132352686 CAGCGCCCGCGCAGGCGCAGGGG + Intergenic
1172260262 20:33558112-33558134 GAGAGCGCGCCCAGGCGCAGTGG - Intronic
1176619151 21:9043130-9043152 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1179818203 21:43921506-43921528 CAGGGCGAGCCCTGGCGCCATGG + Intronic
1180017152 21:45094875-45094897 CAGTGAGCGTCCAGGCCCCTCGG - Intronic
1182321494 22:29480846-29480868 CAGCGCGCGGGCCGCCGCCTCGG - Exonic
1182624521 22:31636103-31636125 CAGCACGCGTCCTGGCGCCGCGG - Intronic
1184368671 22:44068829-44068851 AAGGGCGCGCCCAGGCCCCTGGG - Intronic
1184386883 22:44181641-44181663 CAGCGCCCGCCGTGCCGCCTGGG - Intronic
1184430961 22:44441372-44441394 AAGCCCGCTCCCAGGCCCCTGGG - Intergenic
960047541 3:113212167-113212189 CAGCGCTCGGCCGGGCGCCCGGG + Intronic
962009738 3:131381659-131381681 CGCCCCGCCCCCAGGCGCCTAGG + Intronic
962770836 3:138608973-138608995 CTGCGCCCGCCCGGACGCCTCGG + Intronic
967858456 3:194134873-194134895 CAGCGCGCGCCAATGAGCCCGGG + Intergenic
968930815 4:3577678-3577700 CAGCCCAAGCCCAGGTGCCTGGG - Intronic
968934274 4:3601804-3601826 CAGCGCTGGCCCAGGCGCCTTGG + Intergenic
969493046 4:7510721-7510743 CAGCACGTGCCCAGGCCCCGGGG - Intronic
971288457 4:25312710-25312732 CACAGCGCCCCCAGGCGCTTAGG - Intergenic
974069459 4:57110502-57110524 GAGCGCGCGCGCAGGCCCCGCGG - Intergenic
980990505 4:139735084-139735106 CAGCGCTCGCCCAGACGCGCGGG - Intronic
985609852 5:881353-881375 CAGAGCGCGCACAGGTGCCAAGG + Intronic
986449288 5:7850208-7850230 GAGCTCCCGCCAAGGCGCCTGGG - Intronic
991435921 5:66596871-66596893 CGGCGGGCGCCCGGGCGCCCAGG - Exonic
991967395 5:72107083-72107105 CAGCGGGCGCCCCAGCCCCTTGG + Intergenic
1004174552 6:13328465-13328487 CCGCGCGCGCCCAGACGGCCCGG + Intronic
1018960061 6:168441541-168441563 CTCCCCGTGCCCAGGCGCCTGGG - Intronic
1020010147 7:4802712-4802734 CAGCGTGCCCCGAGGTGCCTGGG - Intronic
1023703134 7:42912032-42912054 CCGCGCGAGCCCCGCCGCCTCGG + Exonic
1024043827 7:45574474-45574496 CCGCCCGCGCCCCGGCGCCCCGG + Intronic
1025608166 7:63054292-63054314 CTGCGCTCGCCCAGGCCCCGAGG + Intergenic
1029563796 7:101321607-101321629 CTGCGCTCGCCCAGGCCCCGAGG + Intronic
1030176534 7:106660528-106660550 CAGCCCGCGGCCAGGCGCGCCGG - Exonic
1032125311 7:129188984-129189006 CTCCGCGCGCCCCGGCCCCTCGG - Exonic
1038644332 8:29350291-29350313 CCTCGCGCGCCCAGCCGCCTCGG - Exonic
1041449878 8:57994907-57994929 CTGCGCGCGGCCAGGCGGCGCGG + Intronic
1044569404 8:93700575-93700597 CAGCGCGCGCCCAGGCGCCTTGG + Exonic
1049313566 8:141946942-141946964 CAGCTCCAGCCCAGGAGCCTTGG - Intergenic
1049714343 8:144082834-144082856 CGGCGCGAGCCCAGGGCCCTCGG - Intronic
1050110814 9:2213995-2214017 CAGGGCACACCCAGGGGCCTGGG + Intergenic
1050148194 9:2592176-2592198 CATCGCAGGCCCAGGGGCCTAGG - Intergenic
1052993492 9:34536741-34536763 CAGGGCACACCCAGGGGCCTGGG + Intergenic
1053358241 9:37465118-37465140 CTGCGCGCTCCCCGACGCCTTGG + Intronic
1053425370 9:38006668-38006690 CAGCGAGGGCTCAGGCCCCTCGG - Intronic
1054455880 9:65430177-65430199 CAGCGCTGGCCCAGGCGCCTTGG - Intergenic
1058681891 9:107447312-107447334 CAGGTCCCGCCCAGGTGCCTTGG - Intergenic
1061563845 9:131424218-131424240 AAGCGTGAGCCCCGGCGCCTGGG + Intronic
1062536347 9:137022726-137022748 CAGTGCGGGCCCGGGCACCTCGG - Exonic
1188451218 X:30309425-30309447 TAGCGCGCACGCAGGCGCGTCGG + Exonic
1189322574 X:40095766-40095788 CGGCGCGCGCCCTGGCGCGCGGG + Intronic