ID: 1044569429

View in Genome Browser
Species Human (GRCh38)
Location 8:93700662-93700684
Sequence CGGGCTGTTACCGGTTTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 49}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044569429_1044569437 7 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569437 8:93700692-93700714 CTGCCCAGGGCCGCCCACACTGG 0: 1
1: 1
2: 1
3: 32
4: 344
1044569429_1044569443 16 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569443 8:93700701-93700723 GCCGCCCACACTGGAGGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 221
1044569429_1044569445 17 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569445 8:93700702-93700724 CCGCCCACACTGGAGGGCTGGGG 0: 1
1: 0
2: 7
3: 308
4: 6689
1044569429_1044569450 29 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569450 8:93700714-93700736 GAGGGCTGGGGTGAGGGAAGTGG 0: 1
1: 2
2: 27
3: 317
4: 2780
1044569429_1044569439 10 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569439 8:93700695-93700717 CCCAGGGCCGCCCACACTGGAGG 0: 1
1: 0
2: 1
3: 36
4: 251
1044569429_1044569442 15 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569442 8:93700700-93700722 GGCCGCCCACACTGGAGGGCTGG 0: 1
1: 1
2: 1
3: 22
4: 257
1044569429_1044569432 -6 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569432 8:93700679-93700701 AGCCCGAGCCCAGCTGCCCAGGG 0: 1
1: 2
2: 19
3: 48
4: 287
1044569429_1044569449 23 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569449 8:93700708-93700730 ACACTGGAGGGCTGGGGTGAGGG 0: 1
1: 0
2: 11
3: 44
4: 538
1044569429_1044569431 -7 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569431 8:93700678-93700700 CAGCCCGAGCCCAGCTGCCCAGG 0: 1
1: 0
2: 4
3: 53
4: 436
1044569429_1044569441 11 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569441 8:93700696-93700718 CCAGGGCCGCCCACACTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 151
1044569429_1044569448 22 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569448 8:93700707-93700729 CACACTGGAGGGCTGGGGTGAGG 0: 1
1: 0
2: 8
3: 93
4: 832

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044569429 Original CRISPR CGGGCTGTTACCGGTTTTCC AGG (reversed) Exonic
900266835 1:1761633-1761655 CGGGCTGTGACCCGGTCTCCAGG + Intronic
901457575 1:9372064-9372086 CGGGCTGATAATGATTTTCCTGG + Intergenic
904511542 1:31014107-31014129 TGGGCTGTCACATGTTTTCCAGG - Intronic
905902956 1:41593955-41593977 CTGGCTGTTACCAGCTTTGCAGG - Intronic
910340201 1:86178280-86178302 CAGGCTGTTTCTGGTTGTCCTGG - Intergenic
918015747 1:180631337-180631359 GGGCCTGTTTCCGGTTTTACTGG + Intergenic
923236740 1:232040857-232040879 CAGGCTGTGAGTGGTTTTCCTGG - Intronic
1082759165 11:57109793-57109815 CTGGCTGTGCCAGGTTTTCCTGG + Intergenic
1086851335 11:91812727-91812749 AGGTCTGTTACAGGTTTTCATGG - Intergenic
1089518435 11:119048352-119048374 CGGGCTGGTACAGCTTGTCCTGG + Exonic
1091857857 12:3753407-3753429 CGGGCTGCTGCCGGGTTTTCGGG - Intronic
1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG + Intronic
1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG + Intronic
1132808539 16:1786944-1786966 CCGGCCGTTACCGTTTTTCTTGG - Exonic
1141284687 16:82660536-82660558 CGGGCTGTTTCTGTTTTGCCAGG - Intronic
1143003499 17:3811164-3811186 TGGGCTGTTACCAGAATTCCTGG - Intergenic
1146935391 17:36809756-36809778 CATCCTGTTACCAGTTTTCCAGG - Intergenic
1149650534 17:58273480-58273502 TGGGCTGGTACCGATTGTCCAGG + Exonic
1150488972 17:65561540-65561562 CGGGCTGTTACTGAGTTGCCAGG + Exonic
1155030740 18:21981382-21981404 CTGGATGTTACAGATTTTCCTGG + Intergenic
1165180565 19:33963913-33963935 CTGGCTGTTATCAGTTGTCCTGG - Intergenic
934748668 2:96777314-96777336 CGGCCTGTTGCCTGTTTTCTAGG + Intronic
942957408 2:181789281-181789303 AGAGCTCTTACAGGTTTTCCAGG - Intergenic
945627552 2:212229670-212229692 AGGGCTGTTACAGCTTATCCAGG + Intronic
945909016 2:215625314-215625336 GGGGCTGCTACCAGTTTCCCTGG + Intergenic
1169241120 20:3981925-3981947 CGGGGTTTTACCTGTTGTCCAGG - Intronic
1172612437 20:36261911-36261933 AGGGCTGTCACGGGTTTTCTGGG + Intronic
1174767585 20:53268521-53268543 CGGGATGGAACCGGTCTTCCTGG + Intronic
1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG + Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
949217144 3:1583561-1583583 TGGGCTGTTCCAGGTGTTCCAGG - Intergenic
960169532 3:114442464-114442486 CTTGCTGTTACTGGTGTTCCTGG - Intronic
961488928 3:127237625-127237647 CGGGCTGTGACCAGTTCTGCTGG - Intergenic
961828838 3:129612918-129612940 CTGGCTGTTCCCTGTTCTCCAGG + Intergenic
963341424 3:144039331-144039353 ATGGCTGTTACAGGTCTTCCAGG - Intronic
966683286 3:182666484-182666506 CGGGGTTTTACCGGTTAGCCAGG - Intergenic
974560902 4:63516314-63516336 TGGGCTTTTACCGGTTTTCAAGG + Intergenic
978325794 4:107552703-107552725 GGGGCTGCTGCCAGTTTTCCAGG + Intergenic
981844512 4:149152272-149152294 CTGTCTGTTTCCTGTTTTCCTGG - Intergenic
994927704 5:106139740-106139762 TGGGCTGTTTCTAGTTTTCCTGG - Intergenic
995797892 5:115961596-115961618 TGGGCTGGAACTGGTTTTCCCGG - Intergenic
1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG + Exonic
1019821831 7:3249599-3249621 CTGGCTTTTACCGGTTGTCCTGG - Intergenic
1028151723 7:87381331-87381353 GGGGCTGTTTCAGGTTTGCCAGG - Intronic
1028738133 7:94241016-94241038 CTGGTTTTTACCAGTTTTCCAGG - Intergenic
1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG + Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1047788993 8:128183124-128183146 CAGGCTGTTAGATGTTTTCCAGG + Intergenic
1055769402 9:79701336-79701358 CTAGCTGTTTCCGGTTTTGCAGG - Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1059433953 9:114265464-114265486 AGGGCTCTTACCGGTTCTCCTGG - Exonic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1187044688 X:15635113-15635135 CTGGCTGGTACAGGTTTTCAAGG + Intronic
1191643658 X:63454880-63454902 CGGGCTCTTACCACTTTTCTCGG - Intergenic