ID: 1044569431

View in Genome Browser
Species Human (GRCh38)
Location 8:93700678-93700700
Sequence CAGCCCGAGCCCAGCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 436}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044569428_1044569431 -6 Left 1044569428 8:93700661-93700683 CCCTGGAAAACCGGTAACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1044569431 8:93700678-93700700 CAGCCCGAGCCCAGCTGCCCAGG 0: 1
1: 0
2: 4
3: 53
4: 436
1044569423_1044569431 27 Left 1044569423 8:93700628-93700650 CCGGCCGTGCGCGAGGCAGCATG 0: 2
1: 0
2: 1
3: 1
4: 89
Right 1044569431 8:93700678-93700700 CAGCCCGAGCCCAGCTGCCCAGG 0: 1
1: 0
2: 4
3: 53
4: 436
1044569421_1044569431 29 Left 1044569421 8:93700626-93700648 CCCCGGCCGTGCGCGAGGCAGCA 0: 1
1: 1
2: 1
3: 5
4: 59
Right 1044569431 8:93700678-93700700 CAGCCCGAGCCCAGCTGCCCAGG 0: 1
1: 0
2: 4
3: 53
4: 436
1044569422_1044569431 28 Left 1044569422 8:93700627-93700649 CCCGGCCGTGCGCGAGGCAGCAT 0: 1
1: 1
2: 0
3: 3
4: 55
Right 1044569431 8:93700678-93700700 CAGCCCGAGCCCAGCTGCCCAGG 0: 1
1: 0
2: 4
3: 53
4: 436
1044569424_1044569431 23 Left 1044569424 8:93700632-93700654 CCGTGCGCGAGGCAGCATGATGA 0: 2
1: 0
2: 0
3: 1
4: 70
Right 1044569431 8:93700678-93700700 CAGCCCGAGCCCAGCTGCCCAGG 0: 1
1: 0
2: 4
3: 53
4: 436
1044569429_1044569431 -7 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569431 8:93700678-93700700 CAGCCCGAGCCCAGCTGCCCAGG 0: 1
1: 0
2: 4
3: 53
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044569431 Original CRISPR CAGCCCGAGCCCAGCTGCCC AGG Intronic
900117205 1:1033823-1033845 CAGCCCCAGCCGAGCACCCCCGG + Intronic
900120698 1:1047518-1047540 CCGCCCAAGCCGGGCTGCCCTGG - Intronic
900130835 1:1086478-1086500 GAGCCCCAGGCCAGCAGCCCTGG - Intronic
900203070 1:1419961-1419983 CAGCCTGGCTCCAGCTGCCCCGG + Intronic
900375225 1:2351173-2351195 CTGCGTGAGCACAGCTGCCCAGG + Intronic
900417090 1:2540265-2540287 CAGCCTCACCCCAGCAGCCCTGG - Intergenic
900421232 1:2556846-2556868 CAGCCCGTCCCCTGCTGCCTGGG + Intronic
900491684 1:2952425-2952447 GAGCCCCAGCCTAGCTTCCCTGG - Intergenic
900598802 1:3494336-3494358 GGGCCCCAGCCCAGCTGCACAGG + Intronic
900610575 1:3542954-3542976 AGGCCTGAGCCCACCTGCCCAGG + Intronic
900644810 1:3704039-3704061 CTCCCCCAGTCCAGCTGCCCAGG - Intronic
900988670 1:6087538-6087560 CAGCCCCGGCCCAGCAGCCACGG + Intronic
901045528 1:6393507-6393529 CACCCCGAGCCCCGCCTCCCAGG + Intronic
901176282 1:7301851-7301873 CACCCTGAGCCAAGCTGCTCTGG + Intronic
901187469 1:7384313-7384335 CTGCACCAGGCCAGCTGCCCCGG - Intronic
902786887 1:18738615-18738637 CAGCTCCACCCCTGCTGCCCTGG + Intronic
903142074 1:21345004-21345026 CCGACCCAGCCCGGCTGCCCTGG + Intronic
903221645 1:21872820-21872842 CAGCCTGAGGCCAGCCTCCCTGG + Intronic
903341828 1:22659532-22659554 CAGGCCCAGCTCAGCTGCACCGG + Exonic
903413712 1:23167879-23167901 CGGCCCCCGCCCAGCCGCCCGGG - Intronic
903538956 1:24086060-24086082 CATCCTGACCCCAGCTTCCCAGG - Intronic
903669623 1:25027827-25027849 CCGCCCGACTCCAGATGCCCTGG + Intergenic
904033210 1:27545964-27545986 CTGCCAGACCCCAGCTCCCCTGG - Intronic
904253004 1:29237867-29237889 CAGCCCCCGCCCGGCCGCCCGGG - Intronic
905180225 1:36160971-36160993 CAGCCCCAGCAGGGCTGCCCAGG - Intronic
906197191 1:43936432-43936454 CTGCCCGAGCGCGGCTGCCCGGG - Exonic
907740545 1:57161394-57161416 CAGGTGCAGCCCAGCTGCCCAGG - Intronic
908817562 1:68049999-68050021 CAGCCTGAGGCCAGGTGGCCTGG - Intronic
912410541 1:109478036-109478058 CAGCACCAGCCCTGCTGCCCAGG + Intronic
912492674 1:110070636-110070658 CAGCGCGAGCCCCGGAGCCCCGG - Exonic
912558483 1:110533409-110533431 CAGCGGCAGCTCAGCTGCCCTGG - Intergenic
913147682 1:116008208-116008230 CAGGGTGAGCACAGCTGCCCAGG + Intronic
914197380 1:145454533-145454555 CATCCCCGGCCCAGCGGCCCCGG + Intergenic
915143900 1:153783478-153783500 CAGCCGCAGCCCAGCGGCGCAGG - Intergenic
915720201 1:157978992-157979014 GCGCCCGGGCCCAGCTGCCGCGG - Intergenic
916166583 1:161971476-161971498 CAGCCTGAGCCCAGGTGCTGAGG - Intergenic
916562718 1:165947436-165947458 CACCATGAGCCCAGCTGACCTGG - Intergenic
916714840 1:167439856-167439878 CAGCCATCGCCCGGCTGCCCCGG + Intronic
917707485 1:177648969-177648991 CAGCCCCATACCACCTGCCCAGG - Intergenic
919036254 1:192312671-192312693 GAGCCCGTGCCCAGCTGACACGG + Intergenic
920380149 1:205530446-205530468 CAGCCCCAGCAGAGCAGCCCCGG + Intronic
922150943 1:223003848-223003870 CATCGCCAGCCCAGCTTCCCAGG + Exonic
922579813 1:226688533-226688555 CAGCAGCAGCCCAGCTGCTCGGG + Intronic
922803582 1:228374784-228374806 CAGCCCCAGCCCAGCCTCCCTGG - Intronic
922986870 1:229872792-229872814 CAGCCCCTGCCCTGCTGCCTAGG - Intergenic
923137940 1:231134652-231134674 CAGCCTCAGCCAAGCAGCCCAGG - Intergenic
1065175335 10:23069926-23069948 CAGCCAAAGCCTACCTGCCCTGG - Intergenic
1067375836 10:45727226-45727248 TAGCCCCAGCCAAGCTGCCCGGG - Exonic
1067497775 10:46774934-46774956 CGGCCCGGGCCCAGCGACCCCGG - Intergenic
1067596874 10:47565480-47565502 CGGCCCGGGCCCAGCGACCCCGG + Intergenic
1067661620 10:48240387-48240409 CAGCGAGAGCCCAGCGGCACAGG - Exonic
1067810827 10:49426000-49426022 CACCCCATGCCCAGCAGCCCAGG + Intergenic
1067883547 10:50067914-50067936 TAGCCCCAGCCAAGCTGCCCGGG - Intronic
1067973173 10:50993603-50993625 AAGCCCTAGCCCGGCAGCCCTGG - Intronic
1069513300 10:69057873-69057895 CAGCACGAGTCGAGCAGCCCAGG + Intergenic
1069568076 10:69477022-69477044 CAGCAGGAACCCAGCTGCCCTGG + Intronic
1069788695 10:71005808-71005830 CGGCCCCAGCCTAGCTGCACTGG - Intergenic
1070142215 10:73746875-73746897 CAGCCCCAGCCCATCTACCCAGG + Exonic
1070154300 10:73824249-73824271 CAGGGCTATCCCAGCTGCCCGGG - Intronic
1070918337 10:80169015-80169037 CAGCCAGTGCCGAGCTACCCAGG - Exonic
1071306101 10:84299986-84300008 CAGCCAGGGCCCAGGTGACCTGG + Intergenic
1071598814 10:86946309-86946331 CTGCCCCATTCCAGCTGCCCTGG + Intronic
1073105480 10:101030216-101030238 CCGCCCTAGCCCAGCCGCCATGG - Exonic
1073180596 10:101580736-101580758 CTGCCCCAGCCCACGTGCCCAGG + Intronic
1073284055 10:102376587-102376609 AAGCCAGGGCCCAGCCGCCCAGG + Exonic
1073439369 10:103543649-103543671 CAGCCCCAGCCCTGCAGCCATGG - Intronic
1074108637 10:110407317-110407339 CAGCAGGAGCCCAGCTCCACAGG - Intergenic
1075399417 10:122150423-122150445 CTCCCCGAGCACGGCTGCCCAGG + Intronic
1075516024 10:123109004-123109026 CACCCACAGCCCAGCTTCCCTGG + Intergenic
1075913285 10:126144921-126144943 AAGCCAGAGTCCAGCTACCCAGG - Intronic
1076340914 10:129744303-129744325 CAGCTTGTGCACAGCTGCCCAGG - Intronic
1076543112 10:131226957-131226979 CAGCACGAGAGCAGCTGCTCAGG + Intronic
1076717746 10:132374935-132374957 CAGAGCCAGCCCCGCTGCCCCGG - Intronic
1076731000 10:132438826-132438848 CAGGCCCAGCCCAGCACCCCTGG + Intergenic
1076751897 10:132547468-132547490 GAGCCCGGGCCCAGCTGCCGTGG + Intronic
1076813833 10:132904381-132904403 CAGCGGGAGCCCCTCTGCCCTGG - Intronic
1076834490 10:133014265-133014287 CAGCCCGAGGCCTGGAGCCCTGG - Intergenic
1076853221 10:133103151-133103173 CAGCTGGAGCCCGGCTGCTCTGG + Intronic
1077097303 11:804556-804578 CAGCCCAGGCCCAGATGGCCTGG - Intronic
1077307963 11:1876351-1876373 AAGGCCCAGCCCAGCTCCCCAGG + Intronic
1077394198 11:2313158-2313180 TACCCGGAGCCCAGCTGCCCGGG + Intronic
1080641752 11:34162436-34162458 CAGTCTGTGCTCAGCTGCCCTGG + Intronic
1080696342 11:34606091-34606113 CAGCCCAAACACAGCTTCCCTGG - Intergenic
1081635105 11:44715859-44715881 AAACCCAAGCCCAGGTGCCCTGG + Intergenic
1081664629 11:44909696-44909718 CAGGCCCCGCCCAGCTGCTCGGG - Exonic
1081675522 11:44966845-44966867 CAGGCCGGGCCCAGGGGCCCTGG - Intergenic
1083173483 11:60936065-60936087 CCGCCCGAGCCCTGCCGCCGGGG + Exonic
1083201916 11:61125855-61125877 CAGCCTGACCCCAGCACCCCAGG + Intronic
1083303093 11:61748938-61748960 CAGCCCTAGCCCAGCAGACATGG - Intergenic
1083791627 11:64989644-64989666 CAGCCTGGTCCCAGCAGCCCAGG + Exonic
1084118718 11:67056733-67056755 GGGCCCCAGCCCAGCCGCCCGGG + Intergenic
1084143582 11:67250670-67250692 CATCCTGAGCCCAACTGCCCCGG - Exonic
1084275510 11:68049286-68049308 CAGCCGCAGCCCACCTGCCGGGG - Exonic
1084450108 11:69231773-69231795 CTGCCCGAGCCCACGTGGCCAGG + Intergenic
1084520911 11:69662276-69662298 CAACCCAAGCCCAGCTGCTCTGG + Intronic
1084938648 11:72600756-72600778 CAACCCAGGGCCAGCTGCCCAGG + Intronic
1085022399 11:73217928-73217950 CTGCCCCAGCCCGGCTGGCCAGG - Intergenic
1085037404 11:73308600-73308622 CTGCCCGAGGCCAGCCCCCCCGG + Exonic
1085242452 11:75069946-75069968 AATCCCAATCCCAGCTGCCCAGG + Intergenic
1085458173 11:76677560-76677582 AAGCCCCAGCCCAGCTCCCAGGG - Intergenic
1086949772 11:92880167-92880189 CAGCCTTTGCCCAGCTCCCCTGG - Intronic
1087137920 11:94739417-94739439 CAGCCCCACCCCTGCTTCCCTGG + Intronic
1087855871 11:103091691-103091713 CAGCCCCAGCCCGGCAGGCCGGG + Intronic
1088470444 11:110183758-110183780 CAGACTGAGTCCTGCTGCCCTGG - Intronic
1089284524 11:117396969-117396991 CAGCCCTAGCCCAGCAGCTCTGG + Intronic
1089559535 11:119336890-119336912 CAGCCAGAGCCCCTGTGCCCTGG + Exonic
1089615086 11:119690709-119690731 CAGCCCGTGCCCAGATGTTCAGG + Intronic
1090199899 11:124846465-124846487 GACCCCGAGCCCAGCCTCCCCGG + Intergenic
1090245250 11:125211663-125211685 CAGCTCAGGCCCAGCTGCCCAGG + Intronic
1090425398 11:126603725-126603747 CAGCCCCAGCACACCTGCCCAGG - Intronic
1090680951 11:129057041-129057063 CAGCCGGAGCCCAGTTGACAGGG + Intronic
1091236404 11:134025137-134025159 AAGCCGGGGCCCAGCTGCCTCGG + Intergenic
1091318467 11:134632663-134632685 CAGCATGAGCTCAGCAGCCCAGG - Intergenic
1091338779 11:134794449-134794471 CTGCCCAAGCCCAGCAGCACGGG + Intergenic
1092153696 12:6268554-6268576 CAGCCCCACCACAGCTGACCAGG - Intergenic
1092761282 12:11813278-11813300 CAGCCCCAGCCCACCCGCCAGGG + Intronic
1095098847 12:38161657-38161679 CAATCCGAGCCCTGCGGCCCTGG - Intergenic
1096590419 12:52655292-52655314 CAGCCTGAGCCCAGCAGCAGGGG - Intergenic
1096980707 12:55727088-55727110 GAGCCCGAACCAAGCTGCTCTGG + Intronic
1097246706 12:57611247-57611269 CAGCCCGTGCTCCCCTGCCCCGG - Intronic
1097573078 12:61356820-61356842 CAGCCCCAGCTCAGCACCCCAGG + Intergenic
1100305261 12:93344463-93344485 AAGCTCCAGCTCAGCTGCCCTGG + Intergenic
1102045777 12:109829360-109829382 GGGCTGGAGCCCAGCTGCCCAGG - Intronic
1102206360 12:111093608-111093630 TGGCCCCAGCCCTGCTGCCCTGG - Intronic
1102215895 12:111161114-111161136 CAGCCCTTGCCTGGCTGCCCTGG + Intronic
1102441525 12:112967414-112967436 GAGCCAGAGACCAGCTGGCCTGG - Exonic
1104016799 12:124967070-124967092 GAGGCCAAGCCCAGCTGCTCAGG + Intronic
1104090536 12:125513068-125513090 CAGCCACAGCCCAGCCTCCCCGG + Intronic
1104283116 12:127396534-127396556 CAGCCACAGCCCAGCCTCCCCGG - Intergenic
1104746188 12:131211891-131211913 CAGCCTGAGGCCAGCTGACCAGG + Intergenic
1104787003 12:131456398-131456420 CAGCCTGAGGCTAGCTGACCAGG - Intergenic
1104836438 12:131795186-131795208 CTGCCCGGGCCCAGCTCACCAGG + Intronic
1106567062 13:30895448-30895470 AAGCACCAACCCAGCTGCCCTGG + Intergenic
1113615985 13:111681050-111681072 CAGCCCCTGCCCAGTGGCCCCGG + Intergenic
1113621453 13:111765943-111765965 CAGCCCCTGCCCAGTGGCCCCGG + Intergenic
1113782157 13:112982927-112982949 CAGCCCCAGCCCAGCTCCTGAGG - Intronic
1114620669 14:24094387-24094409 CAGCCCCTGCCCAGGTGCCATGG + Exonic
1117194772 14:53328901-53328923 CAGCCCCAGGTCAGCTCCCCGGG - Intergenic
1117376544 14:55123158-55123180 CAGCCCAACCCCAGCTTCCCAGG + Intergenic
1117802984 14:59464397-59464419 AAGGCCGCGCCCAGCTGCGCGGG + Exonic
1118708559 14:68501700-68501722 CTGCCCAAGCTCAGCTGGCCCGG + Intronic
1118925798 14:70188813-70188835 AAGCCCGAGCCCAGGTCCCTCGG - Exonic
1119762081 14:77158802-77158824 CAGCCCGAATCCTGCTGCCAGGG + Intronic
1121674419 14:95740917-95740939 CAGGCCTGGCCCACCTGCCCTGG - Intergenic
1121846686 14:97178215-97178237 CACCCCCAGCCCACCTGGCCTGG + Intergenic
1122113083 14:99515090-99515112 CCGCCCTGGCCCAGCTGCCATGG - Exonic
1122217050 14:100211621-100211643 CTGCCCCAGCCCAGGTGTCCAGG + Intergenic
1122903768 14:104792691-104792713 CTCCCCGAGCCCAGCTGGCCTGG + Exonic
1122956228 14:105072781-105072803 CCTCCCGACCCCAGCTGCCCAGG - Intergenic
1122969983 14:105148563-105148585 ATGCCCGAGGCCAGCTCCCCCGG - Intronic
1122982321 14:105197225-105197247 CACCCCGACCCCGCCTGCCCAGG - Intergenic
1123001975 14:105300708-105300730 CCGCCCAGGCCCAGCCGCCCAGG + Exonic
1123122740 14:105925588-105925610 CAAGCTGAGCCCAGCTGCCCAGG - Intronic
1123405383 15:20017009-20017031 CAAGCTGAGCCCAGCTGCCCAGG - Intergenic
1123514713 15:21023657-21023679 CAAGCTGAGCCCAGCTGCCCAGG - Intergenic
1123631540 15:22263644-22263666 CAGGCGGTTCCCAGCTGCCCAGG - Intergenic
1123651431 15:22479087-22479109 CTGCCTGACCCCAGCTGCCAGGG + Intergenic
1124399381 15:29335042-29335064 TGGCCCCAGCACAGCTGCCCCGG + Intronic
1124708603 15:31986033-31986055 GAGTCCGAGCCCAGCTGTGCAGG + Intergenic
1125420513 15:39499912-39499934 CAGCCCCAGCTTAGCTGCCTTGG - Intergenic
1126668358 15:51094501-51094523 CAGCCCCAGCCCACCCGCCTGGG + Intronic
1127822880 15:62675531-62675553 GAGCCAAAGCCCAGCTGCCCAGG - Intronic
1128078197 15:64841473-64841495 GAGACCGAGCCGAGCTGCCCTGG - Intergenic
1129661899 15:77557429-77557451 CAGCAAGGGCACAGCTGCCCTGG + Intergenic
1130911448 15:88273702-88273724 CACACTGAGCCCAGCAGCCCAGG + Intergenic
1131978187 15:97967069-97967091 CAGCCGGCACCCAGCTGGCCTGG + Intronic
1132146219 15:99431598-99431620 CTGCCCGTGCCCACTTGCCCTGG + Intergenic
1132333533 15:101028782-101028804 CAGCCTGATCACAGGTGCCCTGG - Intronic
1132464585 16:71814-71836 CAGCCAGACCCCAGATGCTCAGG - Intronic
1132505765 16:307906-307928 CATCACGGGCACAGCTGCCCGGG - Intronic
1132602986 16:782165-782187 CAGCTCTGGCCCCGCTGCCCTGG - Intronic
1132659334 16:1054465-1054487 CAGGCCCAGCCCCCCTGCCCCGG - Intergenic
1132854450 16:2038625-2038647 CTGCCCCTGCCCACCTGCCCTGG + Exonic
1133028864 16:3000358-3000380 CACCCCGACCCCTGCTCCCCAGG - Intergenic
1133225215 16:4337629-4337651 CAGCCCCAGCCCAGCCCGCCGGG + Exonic
1133972503 16:10578048-10578070 CAGCGCCAGCCCATCTGGCCTGG + Intronic
1134290567 16:12900976-12900998 CATCCCGAGCCCCTCTCCCCCGG + Intergenic
1137451162 16:48575821-48575843 CAGCCCAAGACCAGCTACCATGG + Intronic
1139429056 16:66901320-66901342 CATTCCCAGCCCTGCTGCCCAGG - Intergenic
1140478800 16:75251661-75251683 CAGCCCGATCCCAGCATGCCCGG + Intronic
1141648473 16:85379767-85379789 CTGCCAGAGCCCAGCAGCCATGG + Intergenic
1141714283 16:85717795-85717817 AAGCCCCAGCCCTGCTCCCCAGG - Intronic
1141748294 16:85941029-85941051 CAGCCCGAGTTAAGCTGCACTGG - Intergenic
1141971460 16:87486802-87486824 CAGGCGGTTCCCAGCTGCCCAGG + Intronic
1142131345 16:88432945-88432967 CAGTCCCAGCCATGCTGCCCAGG + Exonic
1142211792 16:88811923-88811945 CAGCCCGAGCGCGCCTGCGCGGG + Exonic
1142214948 16:88825570-88825592 CACCCCAGCCCCAGCTGCCCAGG - Intronic
1142611072 17:1109397-1109419 GAGCCCGAGCCCCGGAGCCCGGG - Intronic
1143034901 17:3989211-3989233 CAAGCCGAGGCCAGCTGCCCTGG - Intergenic
1143329374 17:6122092-6122114 CAGCCTGAGCCAAGCTGCATTGG + Exonic
1143974465 17:10819929-10819951 GAGCCAGAGCCCAGCTGGGCTGG + Intergenic
1144954402 17:19011829-19011851 CTGCCCCAGGCCAGCTGGCCTGG + Intronic
1145057601 17:19713806-19713828 CAGCCGGAGCCCAGCGCACCTGG + Exonic
1145889420 17:28404680-28404702 CAGGCCGATCTCAGCTACCCAGG + Exonic
1146127253 17:30238984-30239006 CAGCCTCTTCCCAGCTGCCCAGG - Intergenic
1146819790 17:35975765-35975787 CAGCCCAAGCTCATCTTCCCAGG - Intergenic
1146911925 17:36653799-36653821 CAGCCCCTGCCCAGCTTCCTTGG - Intergenic
1146972706 17:37085635-37085657 GAGCCTCAGCCCGGCTGCCCTGG - Exonic
1147038230 17:37697818-37697840 GCTCCAGAGCCCAGCTGCCCTGG + Intronic
1147179358 17:38674639-38674661 GAGCCCGAGCTCTGCGGCCCCGG - Exonic
1148262267 17:46193656-46193678 GCGCCCGGCCCCAGCTGCCCCGG + Intronic
1148463002 17:47848792-47848814 CATCCCCACCCCAGCTGCCCAGG + Intronic
1149561668 17:57611859-57611881 CAGCAAGAGCCCAGCTGAGCCGG + Intronic
1149602047 17:57899344-57899366 CGCCCAGAGCCCAGCTGCCCAGG + Intronic
1149657253 17:58316727-58316749 CTGGCAGAGCCCAGCTGCCCTGG + Intronic
1151173575 17:72268610-72268632 CAGCCAGACCCCAGATGCTCTGG - Intergenic
1151705054 17:75763089-75763111 CAGGCCGAGCACAGCTTCGCAGG - Exonic
1151964964 17:77426371-77426393 CAGCGTGAGCCCAGGAGCCCCGG + Intronic
1152028434 17:77826696-77826718 CAGCCAGAGTCCTGCTGCCTCGG - Intergenic
1152272399 17:79332327-79332349 CAGGCTGAGCACAGCTGCCAGGG + Intronic
1152630502 17:81408755-81408777 CAGCCCCTGCCCAGCCCCCCTGG + Intronic
1152755279 17:82084602-82084624 CATGCCCAGCCCACCTGCCCTGG - Exonic
1153123731 18:1764346-1764368 CACCCCCAGCCCCACTGCCCTGG - Intergenic
1153997555 18:10454911-10454933 GAGCGCGCGCCCAGTTGCCCGGG + Exonic
1159586484 18:70288512-70288534 CCGCGCGAGCCCAGCGGACCTGG + Intergenic
1160024657 18:75208200-75208222 CGACCCTGGCCCAGCTGCCCGGG + Intronic
1160794925 19:940890-940912 CCGCCAGGGCCCAGCTGGCCCGG - Intronic
1160796356 19:947528-947550 CAGCCCCCACCCAGATGCCCCGG + Intronic
1161016710 19:1987035-1987057 GAGGCCCAGCCCACCTGCCCAGG + Intronic
1161089628 19:2353380-2353402 CGCGCCCAGCCCAGCTGCCCCGG + Exonic
1161238264 19:3208478-3208500 CGGCCCCAGCCCAGCTCCCAGGG + Exonic
1161316617 19:3620354-3620376 CAGCCTTCACCCAGCTGCCCTGG + Intronic
1161649193 19:5473910-5473932 GTGCCCGAGCCCAGCTGGCTAGG + Intergenic
1162017399 19:7853006-7853028 CCGCCCGAGCCCTGTTGCCCTGG - Intronic
1162464467 19:10831695-10831717 TAGCCCAAGCCCAGCCACCCTGG - Exonic
1162497375 19:11030814-11030836 CAGGCCGAGCCCCCCAGCCCGGG - Exonic
1162743076 19:12784021-12784043 CAGCCCCACCCCCGCCGCCCTGG + Intronic
1162744846 19:12792450-12792472 CGGCCCAAGCCCAGCTGCGCCGG - Exonic
1162828712 19:13270675-13270697 CAGGCCCAGCACAGCTGGCCAGG - Intronic
1163232783 19:16015585-16015607 CTGCCAGAGCCCTGCTGACCAGG - Intergenic
1163679412 19:18672113-18672135 CAGCCTGAGCCCAGGTGCAAGGG - Intergenic
1165213585 19:34254316-34254338 CAGCCCGACCCCTCCCGCCCGGG + Intergenic
1165900783 19:39168338-39168360 AGGCCCCACCCCAGCTGCCCCGG - Intronic
1165998978 19:39866244-39866266 CGACCCCCGCCCAGCTGCCCAGG - Intronic
1166046945 19:40235382-40235404 CTGCCCGAACCCAGCTGCTCCGG - Intronic
1166333234 19:42090691-42090713 AAGCCCCAGCCCATCTGCCCAGG + Exonic
1166358664 19:42242481-42242503 CAGCCCGAGCCCCGCAGCCTGGG - Exonic
1167125576 19:47546009-47546031 AAGCCCGGTCCCAGGTGCCCCGG - Intronic
1167560722 19:50225511-50225533 CAGCCCGAGCTGGGCTGGCCTGG + Intronic
1167711661 19:51115477-51115499 CAGCACCATCCCTGCTGCCCGGG + Intergenic
1168266971 19:55228569-55228591 CTGCCAGAACCCAGCTTCCCAGG + Intronic
1168311644 19:55463777-55463799 CAGCCTGAGTCTCGCTGCCCTGG - Intergenic
926673849 2:15602740-15602762 CAGCCCGGGCCCTCCAGCCCGGG - Intronic
927156476 2:20224249-20224271 CAGCCCTGGCCCGGCTCCCCGGG + Intronic
927751251 2:25673047-25673069 CTGCCCGAGCCCGGCTCGCCTGG - Intronic
927901087 2:26819012-26819034 CAGCCCAAGCCCAGCTGTCAGGG - Intergenic
928130298 2:28644249-28644271 CAGCCTGAGCCCAGTGTCCCAGG + Intergenic
931052359 2:58428606-58428628 CAAGCGGAGCCCAGCTGCGCCGG - Intergenic
932094244 2:68832647-68832669 CAGCCCCAGACCAGCTGAGCTGG - Intergenic
932576227 2:72963750-72963772 CAGCCCCAGCCCAGCCTCCCTGG - Intronic
937478950 2:122239635-122239657 CAGCCCCAGCCCAGATCCGCTGG - Intergenic
937863334 2:126730330-126730352 CAGCTCCAGCGCAGGTGCCCTGG + Intergenic
938639673 2:133266128-133266150 CAGCCCGAGCCCCGCTCTACAGG - Intronic
941385291 2:164843884-164843906 TACCCAGAGCACAGCTGCCCTGG + Intergenic
942178143 2:173354817-173354839 CAGCCCGAGCCCCGCCCCTCCGG + Intronic
943222827 2:185132701-185132723 CTGCCCGAGGCCAGCGGCGCAGG - Intergenic
945188892 2:207166441-207166463 CAGCCCGAGCCCAGCCGTCCCGG - Intronic
946727027 2:222671413-222671435 CAGCCCGAGCCGGGCAGCGCGGG - Intergenic
946727156 2:222671895-222671917 GAGCCCAAGCCCCGCGGCCCGGG - Intronic
946878024 2:224149864-224149886 CAGCCCGGGCTCAGAGGCCCTGG - Intergenic
947188166 2:227472769-227472791 CATCCCCAGCCCGGCTGCCCGGG - Intronic
947500725 2:230668881-230668903 CAGCCCAGGCCCAGCTGGTCAGG + Intergenic
947591507 2:231388659-231388681 CTGCCTGGGCCCAGCTGTCCAGG + Intergenic
947597596 2:231423264-231423286 CAGGCTCAGGCCAGCTGCCCAGG - Intergenic
948164051 2:235847775-235847797 CAGCCCAAGCCAAGCTCCCTGGG + Intronic
948560215 2:238847260-238847282 CAACCCGCGCCCAGCAACCCGGG + Intergenic
948583801 2:239005778-239005800 CACCCCAAGACCACCTGCCCTGG + Intergenic
948728423 2:239948552-239948574 CTGCCCGAGCAAAGCTGCCAAGG + Intronic
948740079 2:240040870-240040892 ATGTCCCAGCCCAGCTGCCCGGG + Intergenic
948844217 2:240675550-240675572 CAGCCCCAGCGCCCCTGCCCGGG + Intergenic
948849643 2:240699329-240699351 CAGCCCCAGCGCCCCTGCCCGGG - Intergenic
949001338 2:241615937-241615959 CAGGCCCAGCCCGGCTGGCCTGG + Intronic
1169262616 20:4149250-4149272 CGGCCCGGGCCGAGCAGCCCTGG - Intronic
1169291792 20:4359213-4359235 CTGCCTGAGCCCTGCTCCCCAGG + Intergenic
1169331579 20:4720817-4720839 CACCCAGAGCCCAGAAGCCCGGG + Intergenic
1170058567 20:12234441-12234463 CAGCTAGAGCCCAGCTGGTCAGG + Intergenic
1170594681 20:17796314-17796336 CAGCCAAAGCCCACATGCCCAGG + Intergenic
1171113107 20:22502077-22502099 CAGGCTCAGCCCAGCTGGCCGGG + Intergenic
1171249419 20:23637284-23637306 CACCCGGAGCCCAGCGTCCCAGG + Intronic
1172143774 20:32742795-32742817 CAGCCCAGGCCAAGCTTCCCCGG + Intronic
1172601745 20:36188556-36188578 CAGTCCAGGCCCAGCTGCCAGGG - Intronic
1172618969 20:36307176-36307198 CCCCCCCAGCCCAGGTGCCCGGG - Intronic
1174069568 20:47890029-47890051 CAGCCCTTCCCCAGCTGCCCAGG - Intergenic
1174353002 20:49981723-49981745 CACCCCCACCCCAGCTTCCCTGG - Intergenic
1174401628 20:50279014-50279036 CAGCCCCAGCCCTGCAGCCTTGG + Intergenic
1175225387 20:57441291-57441313 CTGGCCAAGCCCAGCTGCCCAGG - Intergenic
1175227848 20:57455290-57455312 AAGCCGGGGCCCAGCAGCCCTGG - Intergenic
1175256636 20:57652025-57652047 CAGCCCCAGCCCGGCCCCCCTGG + Exonic
1175985357 20:62761689-62761711 CAGCCCAAGACCAGGTGTCCGGG - Exonic
1176001232 20:62832186-62832208 CAGCCTGTGCCCAGCTCACCTGG - Exonic
1176035104 20:63032316-63032338 CAGCCCCAGGACAGCTGCCGTGG + Intergenic
1176107991 20:63398628-63398650 CAGCCCGAGGCCACCAGGCCAGG + Intergenic
1176276922 20:64277940-64277962 CACCCAGTGCCCAGCTGCCCAGG - Intronic
1176276945 20:64278024-64278046 CACCCAGTGCCCAGCTGCCCAGG - Intronic
1176276988 20:64278190-64278212 CACCCAGTGCCCAGCTGCCCAGG - Intronic
1177310069 21:19378995-19379017 CCCCCCGACCCCAACTGCCCTGG - Intergenic
1179539711 21:42076254-42076276 CCGCCCCAGCCCAGCAGCCCTGG - Intronic
1180039007 21:45266186-45266208 GAGCCAGAGACCAGCTGCGCAGG - Intronic
1180094986 21:45552295-45552317 CAGCCTGACCCCTGCTGCTCAGG - Intergenic
1180109486 21:45641537-45641559 CAGCTCCAGCACAGCAGCCCTGG + Intergenic
1180177867 21:46098806-46098828 CAGCCCGGGTCCCGCCGCCCTGG - Intronic
1180895801 22:19331286-19331308 CAGCGCCAGCCCAGCTCCCTGGG - Exonic
1181116935 22:20637175-20637197 CATCCCCAGCACAGCTGGCCTGG + Intergenic
1181174048 22:21026054-21026076 CACGCCCAGCCAAGCTGCCCCGG - Exonic
1181527091 22:23496202-23496224 CAGCCCCAGCCCAGCAGACGGGG - Intergenic
1181698607 22:24607692-24607714 CAGGGCGTGCCCAGCAGCCCCGG - Intronic
1182585739 22:31343476-31343498 CAGCCCCTGCCCACCTGCTCAGG - Intronic
1183066714 22:35368520-35368542 CCGACCACGCCCAGCTGCCCAGG + Intergenic
1183184658 22:36285082-36285104 CCGCCCAACCCCAGCTGTCCTGG - Intronic
1183385161 22:37510064-37510086 CAGCCTGTGCCCAGAAGCCCTGG + Intronic
1183421396 22:37713605-37713627 CAGCCAGACCCCAGCTGCCCTGG - Intronic
1183578208 22:38706013-38706035 GCCCCCGAGCCCAGCTCCCCGGG + Exonic
1184607245 22:45581229-45581251 CAGCCATAGCCCAGGGGCCCGGG - Intronic
1184616451 22:45641309-45641331 CAGCCCCAGCCCTGCTCTCCGGG - Intergenic
1184693088 22:46126194-46126216 CAGCCCACGCCCTGCTGTCCCGG + Intergenic
1184890549 22:47376375-47376397 CAGCCCCTGCCCTGCAGCCCAGG + Intergenic
950161495 3:10764297-10764319 CAGCCCGGGCCTGGCTGGCCCGG - Intergenic
950479679 3:13236702-13236724 CAGCCCTAGCACAGGGGCCCGGG - Intergenic
951022231 3:17793486-17793508 CAGCCTGAGGTCAGCTGCCATGG - Intronic
951117788 3:18885792-18885814 CAGGCCCAGCCCAGCTGAGCTGG - Intergenic
952471560 3:33659057-33659079 CAGGCCGAGCCCAGTGGCGCAGG - Exonic
953459954 3:43074067-43074089 CATCCAGAGCCCAGCTGCAAGGG - Intergenic
953782287 3:45881805-45881827 CTGCCACAGGCCAGCTGCCCTGG + Intronic
954624080 3:52012977-52012999 CAACCTGGGGCCAGCTGCCCAGG - Intergenic
954641201 3:52099115-52099137 CTTCCCCAACCCAGCTGCCCTGG + Intronic
954929606 3:54269636-54269658 CATCCCCAGCCTAGGTGCCCAGG - Intronic
955217772 3:56998586-56998608 CAGCCCGAGCCCTCCTGCCCAGG + Intronic
955331139 3:58048400-58048422 CAGCCGAAGACCAGCTGCACTGG - Intronic
955484569 3:59422981-59423003 CTGCCCCAGCCCCACTGCCCAGG + Intergenic
956740274 3:72270261-72270283 CAGCCCCACCCCAGTGGCCCGGG - Intergenic
960948477 3:122983029-122983051 CAGGCCGACCCCAGCTGGCCAGG + Intronic
961331687 3:126146332-126146354 CAGCCAGCCCCCAGCTGACCTGG + Intronic
961379482 3:126487754-126487776 TGCCCCCAGCCCAGCTGCCCTGG + Intronic
961385322 3:126520093-126520115 CAGCCCCTCCCCACCTGCCCAGG + Intergenic
962128110 3:132643857-132643879 CAGCCCAAGTACAGCTGCCAAGG - Intronic
962437736 3:135382279-135382301 CATCCCAAACCCATCTGCCCAGG + Intergenic
962847859 3:139287029-139287051 CAGCCTGAGTCCAGCTGGGCTGG - Intronic
963076093 3:141347602-141347624 CAGCCGGAGCCTAGGTGACCTGG - Intronic
963262112 3:143203269-143203291 CAGCCCGAGAAAGGCTGCCCTGG + Intergenic
965681025 3:171251495-171251517 CAGCCCCAGCCAACTTGCCCAGG - Intronic
966860909 3:184230475-184230497 CACCCTGCGCCCAGCTTCCCCGG + Exonic
966880163 3:184345495-184345517 CAGCACGAGCCCAGCTGGGCAGG - Intronic
966885755 3:184377383-184377405 CTTCCTGAGACCAGCTGCCCAGG + Intronic
967970928 3:194999067-194999089 CATCCTGAGCCCATCTGCCTGGG + Intergenic
968512612 4:1002236-1002258 CCACCCGGTCCCAGCTGCCCTGG + Intronic
968613604 4:1567769-1567791 CAGCCCCAGCCCAGGGCCCCCGG + Intergenic
968650204 4:1757392-1757414 CAGCCAGAGCCCAGCCTCCAGGG - Intergenic
968673099 4:1862809-1862831 CAGTCCCAGCCCTGCCGCCCTGG + Intergenic
968813685 4:2811127-2811149 CAGCCCCAGCCCTGCTGCCAAGG - Intronic
968818600 4:2834182-2834204 CGGCCCCCACCCAGCTGCCCTGG - Exonic
968930815 4:3577678-3577700 CAGCCCAAGCCCAGGTGCCTGGG - Intronic
969147728 4:5138912-5138934 CAGCTGGAGCCCTGCAGCCCTGG + Intronic
969461959 4:7333671-7333693 TAGCCCAAGCCCAGGGGCCCAGG + Intronic
969586751 4:8098208-8098230 CAGCCCCAGCCCCTCTGGCCTGG + Intronic
970194511 4:13541821-13541843 CAGACTCAGCCCAGCTGCCAGGG + Exonic
972960425 4:44447262-44447284 CAGCCCGCTCCCAGATGCCAGGG - Intronic
973246559 4:48016655-48016677 CCAGCCGAGCCCTGCTGCCCGGG - Intronic
981567206 4:146113984-146114006 CAGGCACAGGCCAGCTGCCCAGG - Intergenic
985656688 5:1135488-1135510 CGTCCCCAGCCCTGCTGCCCCGG + Intergenic
985762525 5:1757617-1757639 TGGCCCCTGCCCAGCTGCCCCGG + Intergenic
986261984 5:6155566-6155588 CAGCCCCAGCCTGGCTGGCCTGG + Intergenic
986291061 5:6399072-6399094 CAACCCGAGCCCAACTGAGCAGG + Intergenic
986485434 5:8231458-8231480 CAGACTGAGCCCAGCTCTCCAGG - Intergenic
987403603 5:17502650-17502672 CAGCCAGAGCCAGGCTGCCTGGG - Intergenic
987411075 5:17615390-17615412 CAGCCAGAGCCAGGCTGCCTCGG - Intergenic
990890737 5:60647092-60647114 CACCCCCACCCCAGCAGCCCTGG + Intronic
996179927 5:120406932-120406954 CATCACAAGCCCAGATGCCCAGG + Intergenic
998903240 5:146877916-146877938 CACTACGCGCCCAGCTGCCCAGG + Intronic
999144033 5:149380997-149381019 CAGCCCCAGCCCCACTGGCCGGG + Intronic
999382655 5:151132307-151132329 CAGCCTCAGCCATGCTGCCCTGG + Intronic
1001328392 5:170745591-170745613 CAACTGGAGCCCAGATGCCCTGG - Intergenic
1002283005 5:178144116-178144138 CAGCACAACCCCAGCTGCCTGGG - Intronic
1004020085 6:11769312-11769334 AATCCCCAGCCCAGCTCCCCAGG - Intronic
1004633290 6:17442448-17442470 CACCCCAAGCACAGCAGCCCTGG - Intronic
1006183688 6:32168658-32168680 CTGCCCTTGCCCAGATGCCCAGG - Exonic
1006437412 6:34033170-34033192 AAGCCTGAGCCAAGCAGCCCTGG - Intronic
1006941716 6:37756127-37756149 CAGCCCGAGTCCAACTACTCAGG - Intergenic
1007118653 6:39362388-39362410 CAGTCCGAGCCCAGCCTCCCAGG - Intronic
1007235238 6:40386377-40386399 CAGCCCCAGCCCATCCGTCCAGG - Intergenic
1007405803 6:41635552-41635574 AAGCCCAGGCCCAGCTTCCCCGG - Intergenic
1007707389 6:43799185-43799207 CAGCCCCATCCCAGGGGCCCAGG - Intergenic
1008294577 6:49760235-49760257 CAGCCCTAGTCAAGCTGCCAAGG - Intergenic
1008541057 6:52546758-52546780 CAGAAGGAGCCCAGCAGCCCAGG + Intronic
1011626120 6:89285216-89285238 CAGACTGGGCCCAGCTACCCTGG + Intronic
1017012249 6:150070549-150070571 CACCCCGAGGCCAGGTGACCTGG + Intergenic
1017146596 6:151240632-151240654 GAGCCCGAGCCCAGCGGCGGCGG + Exonic
1017282113 6:152636787-152636809 CTGCGGGAGCCCAGCCGCCCTGG + Exonic
1018602730 6:165562746-165562768 CAGTCAGAGCCCACCTGGCCTGG + Intronic
1018901249 6:168052812-168052834 CAGCCTGTGCCCAGTGGCCCGGG + Intergenic
1019023307 6:168937325-168937347 CTGCCGGAGGCCAGCTGCTCAGG - Intergenic
1019342352 7:514511-514533 CAGCCCAGGCCCAGGTGGCCTGG + Intronic
1019769887 7:2876975-2876997 CAGCCCGGGCACAGCTCCACGGG - Intergenic
1020034810 7:4958595-4958617 CTGCCCGAGCGTAGCTGGCCTGG + Intronic
1020086962 7:5315751-5315773 CAGCACAAGCCCAGTGGCCCAGG - Intronic
1020282055 7:6654735-6654757 CAGCCCTCGCCCTGCGGCCCCGG + Exonic
1021794797 7:24243324-24243346 CAGCCAAAGCCCAAATGCCCAGG - Intergenic
1022801366 7:33780311-33780333 CAACCTGGACCCAGCTGCCCTGG + Intergenic
1023243698 7:38178265-38178287 CCGCCCGCACCCAGCAGCCCCGG - Exonic
1023344739 7:39259845-39259867 CAGACAGAGCCCAGACGCCCAGG + Intronic
1024085375 7:45888183-45888205 CAGCCCAGGTCCAGCTGGCCAGG - Intergenic
1024700402 7:51899814-51899836 CTGCCTCAGCCCAGCTGCACTGG - Intergenic
1024982617 7:55170397-55170419 GAGCGGGAGCCCAGCTGCTCAGG + Intronic
1025207348 7:57001402-57001424 CAGCACAAGCCCAGTGGCCCAGG + Intergenic
1025232519 7:57211962-57211984 CGGCCCTTCCCCAGCTGCCCAGG - Intergenic
1025664589 7:63575484-63575506 CAGCACAAGCCCAGTGGCCCAGG - Intergenic
1025853992 7:65262876-65262898 AAACCCGAGCCCACCAGCCCCGG + Intergenic
1026100278 7:67378594-67378616 GGGCACGAGGCCAGCTGCCCAGG - Intergenic
1026798696 7:73383228-73383250 CAGCCAGCTCCCAGCTGACCTGG + Intergenic
1026806010 7:73430025-73430047 CAGCCCCAGCCCAGCTCTGCTGG + Intergenic
1027229489 7:76263949-76263971 CAGCCCTAGGCCAGCTCACCAGG - Intronic
1027250149 7:76393740-76393762 CAGCCCCAGCCCAGCCCCTCTGG - Intronic
1028742924 7:94297113-94297135 CAGCCAGAGCACAGCTGCAATGG + Intergenic
1029402952 7:100356880-100356902 CAGGGTGAGTCCAGCTGCCCTGG + Exonic
1029406027 7:100374430-100374452 CAGGGTGAGTCCAGCTGCCCTGG + Exonic
1031974256 7:128084050-128084072 CAGCCCCAGCCCAGCAGCACTGG + Intronic
1032076781 7:128839852-128839874 CAGCTCCAGCCCGGCAGCCCCGG + Intronic
1032201244 7:129824784-129824806 CAGCCTGAGAGCAGCTTCCCGGG - Intergenic
1032711742 7:134466866-134466888 AAGCCCGAGGCCAGGTACCCAGG + Intergenic
1032841232 7:135714900-135714922 CAGCCCGAGGCCTGCAGCGCAGG + Intronic
1033275632 7:139969712-139969734 TAGCCCGACCCCAGCAGACCTGG - Intronic
1033663738 7:143422253-143422275 CAGCCCCTGCACAGCTGTCCCGG - Intergenic
1034122812 7:148642887-148642909 CAAGCAGAGCCCAGCAGCCCGGG - Intergenic
1034487081 7:151372778-151372800 CAGCTCCAGCCCCGCTGCACAGG - Intronic
1034830677 7:154305076-154305098 CAGCCCCAGCCCGGCTGAGCGGG + Intronic
1034906049 7:154947786-154947808 CAGGGTGAGCCCAGCTCCCCTGG + Intronic
1034977083 7:155455067-155455089 CAGCCCCATCCCAGCTTCCCCGG + Intergenic
1035335381 7:158124698-158124720 CTGCAGGAGCCCAGCTGCCGGGG + Intronic
1035373389 7:158393014-158393036 CTGCACAGGCCCAGCTGCCCAGG + Intronic
1035397871 7:158546898-158546920 CAGCCCTGCCCCAGGTGCCCAGG - Intronic
1035826628 8:2651939-2651961 CAGCCAGAGCCTCTCTGCCCTGG + Intergenic
1037417586 8:18667941-18667963 CTGCCCGAGGCCAGCGGCACCGG + Intronic
1037769288 8:21789388-21789410 CAGCCTCAGCTCAGCTCCCCAGG - Intronic
1038540404 8:28386023-28386045 CAGCACGCGCCCGGCTTCCCCGG + Intronic
1039608142 8:38899933-38899955 CGGCCCGAGCCCCCCTCCCCAGG + Intergenic
1039821623 8:41140301-41140323 CACACCGAGCTCAGGTGCCCAGG - Intergenic
1039828640 8:41195412-41195434 CAGCCTCTGCCCCGCTGCCCTGG + Intergenic
1041103830 8:54422555-54422577 TGGCCCCAGCACAGCTGCCCTGG + Intergenic
1042228784 8:66536527-66536549 CTGCCCAAGCCCAGCTCCCCTGG - Intergenic
1042842059 8:73133798-73133820 GAGCACGGGGCCAGCTGCCCAGG + Intergenic
1044569431 8:93700678-93700700 CAGCCCGAGCCCAGCTGCCCAGG + Intronic
1044622101 8:94200694-94200716 CAGAGCAAGCCCAGCAGCCCTGG - Intronic
1045231293 8:100309754-100309776 CAGCCCTAGCGCCCCTGCCCGGG - Intronic
1045815012 8:106269588-106269610 CAGCCCGCTCCAAGCTGCCTTGG + Intergenic
1046071631 8:109262527-109262549 CAGTCAGAGCTCACCTGCCCTGG + Intronic
1046962607 8:120126186-120126208 GCGCCGAAGCCCAGCTGCCCCGG - Intronic
1047932791 8:129747732-129747754 GAGCACGAGACCAGCTGTCCAGG + Intergenic
1049064454 8:140301906-140301928 CTCCCAGAGCTCAGCTGCCCTGG + Intronic
1049201685 8:141343542-141343564 CATCCCTGGGCCAGCTGCCCAGG + Intergenic
1049471773 8:142777902-142777924 CAGCCCAGGCCCAGCAGCTCCGG + Exonic
1049586526 8:143434979-143435001 CTGCCAGAGCACAGCTGCGCAGG + Intergenic
1049628098 8:143635778-143635800 CAGCCCAAGACCAGCTTCTCAGG - Intergenic
1049662386 8:143825338-143825360 CACCACCAGCCCAGCTGCACTGG + Intronic
1049797855 8:144504726-144504748 CACCCCCAGCCCATGTGCCCTGG + Intronic
1051174956 9:14351386-14351408 CAGCCCTAGCCCAGCTCCCTAGG - Intronic
1051515817 9:17929491-17929513 CAGCCCCTGCCTAGCTCCCCAGG + Intergenic
1053865648 9:42435262-42435284 CAGCCAAAGCCCACCGGCCCAGG + Intergenic
1054459304 9:65454235-65454257 CAGCCCAAGCCCGGGTGCCTGGG + Intergenic
1055658198 9:78473346-78473368 CAGTATGAGCCCAGGTGCCCAGG + Intergenic
1056679321 9:88703329-88703351 CAGGCCCAGGTCAGCTGCCCAGG + Intergenic
1056757661 9:89392011-89392033 CACCCAGAGCCCATCTGACCGGG + Intronic
1056826423 9:89879324-89879346 CAGGCCCAGCACAGCTGTCCAGG + Intergenic
1058670444 9:107356828-107356850 CAGCCCTAGCACGGCTGCCTGGG + Intergenic
1058740798 9:107940211-107940233 CAGCCAGAGCCCAGCTCTCAGGG + Intergenic
1058886744 9:109327387-109327409 CAGCAGCAGCCCAGCTGCCAAGG - Intergenic
1059421642 9:114196107-114196129 CAGCCCCAGCCCAGCTCCCCTGG + Intronic
1059824966 9:118017898-118017920 CAGGCCAACCCCAGCGGCCCTGG - Intergenic
1060300804 9:122373629-122373651 GAGCCCCAGGCCAGCTGACCCGG + Intronic
1060404655 9:123367382-123367404 CAGCCCATGTCCAGATGCCCAGG + Intronic
1060783349 9:126430119-126430141 TAGCCTCAGCCCAGTTGCCCAGG + Intronic
1061430339 9:130526817-130526839 CAGCCTGGGCCCAGGTGGCCCGG - Intergenic
1061728760 9:132597144-132597166 GAGCCCCAGCCCAGCTGTCAGGG - Intronic
1061744885 9:132732446-132732468 CAGGCCCAGCCCTGCAGCCCTGG - Intronic
1061819377 9:133217648-133217670 CAGCCCCAGCCCACCTGCCTTGG + Intergenic
1061899825 9:133667044-133667066 AAGCCCGAGCCCTGCTGTCCAGG - Intronic
1062155348 9:135045289-135045311 CAGCGTGAGACCTGCTGCCCAGG + Intergenic
1062187404 9:135225223-135225245 CAGCCAGCGCCCAGCTCCTCTGG + Intergenic
1062353171 9:136148950-136148972 CAGCCTGGCCTCAGCTGCCCTGG - Intergenic
1062368231 9:136222321-136222343 CAGCACGAGGCCTGCTGCCCCGG - Intronic
1062501734 9:136854716-136854738 CAGCCACAGCCCAGTGGCCCTGG + Intronic
1062538797 9:137032429-137032451 CAGCCCCCACCCAGCTACCCAGG + Exonic
1062546983 9:137068286-137068308 CAGACCGGGCCCAGGTGTCCTGG - Intronic
1062562711 9:137148897-137148919 CAGCCCTAGCTAAGCTGCCTCGG + Intronic
1062682477 9:137789178-137789200 CTGCCCGAGCCCTCCTCCCCGGG + Intronic
1062696302 9:137877892-137877914 CATCCCCGGCCCAGCGGCCCCGG - Exonic
1187698205 X:21941219-21941241 CCGCCCGCGCCCGGCAGCCCGGG - Intronic
1190049264 X:47137446-47137468 CATGCCCAGCCCAGTTGCCCAGG + Intergenic
1190108296 X:47574104-47574126 CAGCCTCGGCCCAGCGGCCCGGG - Exonic
1192503781 X:71668926-71668948 GAGCCCAAGCACAGCAGCCCTGG + Intergenic
1192522543 X:71814978-71815000 GAGCCCAAGCACAGCAGCCCTGG + Intergenic
1194758343 X:97764099-97764121 CTGCCCCAGCTCAGTTGCCCAGG - Intergenic
1196454107 X:115882706-115882728 CAGCCCCAGCCCTGCCCCCCGGG - Intergenic
1199722540 X:150552320-150552342 CAGCCCAAGCTCAGCTTCTCTGG + Intergenic
1200073362 X:153539613-153539635 AGGCGTGAGCCCAGCTGCCCAGG + Intronic
1200230697 X:154442490-154442512 CAGCCAGAGCCCAGCGCCCAGGG - Intronic