ID: 1044569432

View in Genome Browser
Species Human (GRCh38)
Location 8:93700679-93700701
Sequence AGCCCGAGCCCAGCTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 2, 2: 19, 3: 48, 4: 287}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044569428_1044569432 -5 Left 1044569428 8:93700661-93700683 CCCTGGAAAACCGGTAACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1044569432 8:93700679-93700701 AGCCCGAGCCCAGCTGCCCAGGG 0: 1
1: 2
2: 19
3: 48
4: 287
1044569429_1044569432 -6 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569432 8:93700679-93700701 AGCCCGAGCCCAGCTGCCCAGGG 0: 1
1: 2
2: 19
3: 48
4: 287
1044569421_1044569432 30 Left 1044569421 8:93700626-93700648 CCCCGGCCGTGCGCGAGGCAGCA 0: 1
1: 1
2: 1
3: 5
4: 59
Right 1044569432 8:93700679-93700701 AGCCCGAGCCCAGCTGCCCAGGG 0: 1
1: 2
2: 19
3: 48
4: 287
1044569423_1044569432 28 Left 1044569423 8:93700628-93700650 CCGGCCGTGCGCGAGGCAGCATG 0: 2
1: 0
2: 1
3: 1
4: 89
Right 1044569432 8:93700679-93700701 AGCCCGAGCCCAGCTGCCCAGGG 0: 1
1: 2
2: 19
3: 48
4: 287
1044569424_1044569432 24 Left 1044569424 8:93700632-93700654 CCGTGCGCGAGGCAGCATGATGA 0: 2
1: 0
2: 0
3: 1
4: 70
Right 1044569432 8:93700679-93700701 AGCCCGAGCCCAGCTGCCCAGGG 0: 1
1: 2
2: 19
3: 48
4: 287
1044569422_1044569432 29 Left 1044569422 8:93700627-93700649 CCCGGCCGTGCGCGAGGCAGCAT 0: 1
1: 1
2: 0
3: 3
4: 55
Right 1044569432 8:93700679-93700701 AGCCCGAGCCCAGCTGCCCAGGG 0: 1
1: 2
2: 19
3: 48
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044569432 Original CRISPR AGCCCGAGCCCAGCTGCCCA GGG Intronic
900159415 1:1216402-1216424 GCCCTGAGCCCACCTGCCCAGGG - Intergenic
900188334 1:1343166-1343188 CCCCCGTGCCCAGCTGCCCTCGG + Intronic
900349406 1:2227688-2227710 CGCCCGCGCCCAGCGGCCCTCGG + Intergenic
900375226 1:2351174-2351196 TGCGTGAGCACAGCTGCCCAGGG + Intronic
900491683 1:2952424-2952446 AGCCCCAGCCTAGCTTCCCTGGG - Intergenic
900610576 1:3542955-3542977 GGCCTGAGCCCACCTGCCCAGGG + Intronic
901490619 1:9594650-9594672 AGCGGGAGCCCTGCTTCCCAGGG + Intronic
901597808 1:10399138-10399160 AGGCCGAGCCGGGCTGCCCCTGG - Intronic
901604616 1:10449438-10449460 GGCCAGAGCCCGGCTGCCCCAGG + Intronic
902335171 1:15750314-15750336 ACCCCAATCCCAGCTGCCCCAGG - Intergenic
902527906 1:17071272-17071294 ACCCCGAGCACAGCAGCACAGGG - Intronic
902649284 1:17826218-17826240 AGCCGGGGCCCAGCATCCCACGG + Exonic
902797489 1:18808850-18808872 CGCCCCAGCCCATCTCCCCAAGG - Intergenic
903538955 1:24086059-24086081 ATCCTGACCCCAGCTTCCCAGGG - Intronic
906191096 1:43899996-43900018 AGCCAGACCCCAGCAGCCCCAGG + Intronic
906286340 1:44590272-44590294 AGCCCAAGCCCTGCTGGGCAAGG + Intronic
907305666 1:53511719-53511741 AGCTCGTGCACAGCTGTCCACGG - Intronic
907400059 1:54219554-54219576 AGCCCCAGGTCAGCTGCCCTAGG - Intronic
907847119 1:58219131-58219153 ACCCACAGCCCAGCTTCCCAAGG + Intronic
908710093 1:67005358-67005380 AGCCCCAGACCAGCTGCAGAAGG + Intronic
908873714 1:68645575-68645597 ACCGGGAGCACAGCTGCCCAGGG - Intergenic
915720200 1:157978991-157979013 CGCCCGGGCCCAGCTGCCGCGGG - Intergenic
916159104 1:161890864-161890886 GGCCCAAGCACAGCTGGCCAAGG + Intronic
916166582 1:161971475-161971497 AGCCTGAGCCCAGGTGCTGAGGG - Intergenic
917707484 1:177648968-177648990 AGCCCCATACCACCTGCCCAGGG - Intergenic
917724527 1:177816168-177816190 AGCCCCAGCCCAGGTGCTCCAGG + Intergenic
919835881 1:201572978-201573000 AGCCTGAGCCCAGCAGCCCAAGG + Intergenic
920913001 1:210234308-210234330 TGCCCGAGCCCTGGTGCCCAAGG - Intronic
923137939 1:231134651-231134673 AGCCTCAGCCAAGCAGCCCAGGG - Intergenic
1065894875 10:30154439-30154461 ACCCAAAGCCCACCTGCCCACGG - Intergenic
1065979478 10:30878128-30878150 AGCCTGAAACCTGCTGCCCAAGG + Intronic
1066623308 10:37380811-37380833 AGGCTGAGCCCTGCTGCCCCTGG - Intronic
1067067458 10:43111999-43112021 AGCACCAGCTGAGCTGCCCACGG - Intronic
1067375835 10:45727225-45727247 AGCCCCAGCCAAGCTGCCCGGGG - Exonic
1067462023 10:46465298-46465320 ACCCCAAGCCCAGCAGCCCCAGG - Intronic
1067625172 10:47919300-47919322 ACCCCAAGCCCAGCAGCCCCAGG + Intergenic
1067883546 10:50067913-50067935 AGCCCCAGCCAAGCTGCCCGGGG - Intronic
1067973172 10:50993602-50993624 AGCCCTAGCCCGGCAGCCCTGGG - Intronic
1069568077 10:69477023-69477045 AGCAGGAACCCAGCTGCCCTGGG + Intronic
1069826128 10:71256340-71256362 CTCCTGAGCCCAGCTGCCAATGG - Intronic
1070142216 10:73746876-73746898 AGCCCCAGCCCATCTACCCAGGG + Exonic
1071488012 10:86115742-86115764 AGCCCCATCCCAGCTGCTCCTGG + Intronic
1071503775 10:86221079-86221101 AGACAGAGCCCAGCTGGCCCTGG + Intronic
1071643515 10:87340515-87340537 AGCTCGAGCCCAGGAGTCCAAGG - Intergenic
1075399418 10:122150424-122150446 TCCCCGAGCACGGCTGCCCAGGG + Intronic
1075783714 10:125033805-125033827 CCCCTGGGCCCAGCTGCCCAGGG - Intronic
1075788013 10:125063070-125063092 AGGCTGTGCACAGCTGCCCAGGG - Intronic
1076543113 10:131226958-131226980 AGCACGAGAGCAGCTGCTCAGGG + Intronic
1076594754 10:131618774-131618796 GGCCTGAGCCCAGCGCCCCACGG + Intergenic
1076771495 10:132668279-132668301 AGGCCGAGGCCATCAGCCCATGG - Intronic
1077198927 11:1295847-1295869 AGCCCGACAGCAGCTGCCCCCGG + Intronic
1077335374 11:2001145-2001167 AGCCCGAGCCCGGCTACCTGTGG - Intergenic
1077351453 11:2095043-2095065 AGCCCGGGAGCAGCTTCCCAGGG + Intergenic
1077376696 11:2208617-2208639 AGCCTGTGCCCAGCAGGCCAGGG - Intergenic
1077378019 11:2214742-2214764 AGCACGGGTCCAGCTGCCCCAGG + Intergenic
1078191500 11:9095294-9095316 AGCCTCAGCCCAGCTGCCATTGG - Intronic
1079386117 11:19981321-19981343 AGCCCCAGCCCAGCTACACCCGG - Intronic
1079881869 11:25938517-25938539 ATCCCAAGCTCTGCTGCCCAGGG - Intergenic
1080864483 11:36181040-36181062 TGCCCGAGATCAGCTACCCAAGG - Intronic
1083201917 11:61125856-61125878 AGCCTGACCCCAGCACCCCAGGG + Intronic
1084774376 11:71365793-71365815 AACACTAGCCCAGCTGCGCACGG - Intergenic
1085242453 11:75069947-75069969 ATCCCAATCCCAGCTGCCCAGGG + Intergenic
1085506921 11:77066311-77066333 AGCCCGAGCCCGGGAGCCCATGG + Intergenic
1089209715 11:116791822-116791844 AGCCAGAGCCCAGGTGAGCACGG + Exonic
1089282767 11:117386002-117386024 AGCTCGAGCCCCGCTGCAGATGG - Intronic
1090199900 11:124846466-124846488 ACCCCGAGCCCAGCCTCCCCGGG + Intergenic
1090245251 11:125211664-125211686 AGCTCAGGCCCAGCTGCCCAGGG + Intronic
1202818357 11_KI270721v1_random:56327-56349 AGCCCGAGCCCGGCTACCTGTGG - Intergenic
1091407941 12:220697-220719 AGCCCCCACCCAGCTTCCCAAGG + Exonic
1092153695 12:6268553-6268575 AGCCCCACCACAGCTGACCAGGG - Intergenic
1096621717 12:52869580-52869602 AGCCCCATCCCAGCTTCCCCAGG + Intergenic
1098618519 12:72560601-72560623 AGCTCGAGCCCAGGAGCTCAAGG + Intronic
1101986038 12:109447800-109447822 AGCCCAATCCCAGCAGCTCAGGG - Exonic
1102206359 12:111093607-111093629 GGCCCCAGCCCTGCTGCCCTGGG - Intronic
1102688696 12:114743786-114743808 ATCCCAAGCTCAGCTGCCCTTGG - Intergenic
1102774671 12:115508166-115508188 GGCCCCAGGCCAGCTTCCCAGGG + Intergenic
1103584613 12:121942706-121942728 AGCCTGAACAGAGCTGCCCATGG - Intronic
1104016800 12:124967071-124967093 AGGCCAAGCCCAGCTGCTCAGGG + Intronic
1104746189 12:131211892-131211914 AGCCTGAGGCCAGCTGACCAGGG + Intergenic
1104787002 12:131456397-131456419 AGCCTGAGGCTAGCTGACCAGGG - Intergenic
1104789770 12:131474185-131474207 AGCCCGAGTCCATCTGACCCTGG + Intergenic
1104836439 12:131795187-131795209 TGCCCGGGCCCAGCTCACCAGGG + Intronic
1104874425 12:132023993-132024015 ACCATGAGCCCTGCTGCCCACGG + Intronic
1105068915 12:133222064-133222086 ACCTGGTGCCCAGCTGCCCAGGG + Intronic
1106567063 13:30895449-30895471 AGCACCAACCCAGCTGCCCTGGG + Intergenic
1111518299 13:89363480-89363502 AGCCGGCGCCCACCTGCCCGCGG - Intergenic
1113419373 13:110158462-110158484 AGCTCCTGCCCAGCTGCCCCAGG - Intronic
1113544794 13:111139842-111139864 TGCCTGCGGCCAGCTGCCCATGG - Intronic
1113782156 13:112982926-112982948 AGCCCCAGCCCAGCTCCTGAGGG - Intronic
1117802985 14:59464398-59464420 AGGCCGCGCCCAGCTGCGCGGGG + Exonic
1117803219 14:59465321-59465343 CGGCCGAGCCCAGCTCCCCGCGG - Exonic
1119516284 14:75251237-75251259 AGCCCCAGCCCAGATGGACAAGG + Intronic
1119718463 14:76875066-76875088 AGCCTCACCCCAGCTGCCCTTGG - Intergenic
1121338488 14:93091409-93091431 AGCCCGAGGCCAGCTGTGGAGGG - Intronic
1121619456 14:95336303-95336325 AGCCAGAGCCCATGAGCCCAAGG + Intergenic
1122846061 14:104499875-104499897 GGCCAGAGCCCAGGTGACCAGGG + Intronic
1122956227 14:105072780-105072802 CTCCCGACCCCAGCTGCCCAGGG - Intergenic
1122982320 14:105197224-105197246 ACCCCGACCCCGCCTGCCCAGGG - Intergenic
1123103251 14:105819746-105819768 AGCCCGTGTCCAACTGACCAGGG + Intergenic
1123702754 15:22928016-22928038 AGCCCGTGACCACCTGCACAAGG + Exonic
1124641936 15:31401343-31401365 AGTCCTTGCCCACCTGCCCAGGG + Intronic
1127822879 15:62675530-62675552 AGCCAAAGCCCAGCTGCCCAGGG - Intronic
1128078196 15:64841472-64841494 AGACCGAGCCGAGCTGCCCTGGG - Intergenic
1129071077 15:72952210-72952232 AGCCTGATGCCAGCTGCCCCAGG + Intergenic
1129917165 15:79283773-79283795 AGCCCGAGCCCCGCCGCCCGAGG + Intergenic
1130258022 15:82334819-82334841 AGCCAGAGGGCTGCTGCCCAGGG + Intergenic
1131059469 15:89395722-89395744 CGTCTGAGCCCAGCTGCACAGGG - Intergenic
1132304801 15:100803354-100803376 AGCCTGAGCGCAGCTGGCGATGG - Intergenic
1132464584 16:71813-71835 AGCCAGACCCCAGATGCTCAGGG - Intronic
1132703271 16:1230961-1230983 AGACCCAGCCCAGCTCCCCATGG + Intergenic
1132703283 16:1230994-1231016 AACCCCAGCCCAGCTCCCCATGG + Intergenic
1132703296 16:1231027-1231049 AGCCCCAGCCCAGCTCCCCATGG + Intergenic
1132703309 16:1231060-1231082 AGCCCCAGCCCAGCTGCCCATGG + Intergenic
1132703333 16:1231126-1231148 AGCCCCAGCCCAGCTCCCCATGG + Intergenic
1132703346 16:1231159-1231181 AGCCCCAGCCCAGCTCCCCATGG + Intergenic
1132703380 16:1231259-1231281 AGCCCCAGCCCAGCTCCCCATGG + Intergenic
1132703393 16:1231292-1231314 AGCCCCAGCCCAGCTCCCCATGG + Intergenic
1132703420 16:1231359-1231381 AGCCCCAGCCCAGCTCCCCATGG + Intergenic
1132703433 16:1231392-1231414 AGCCCCAGCCCAGCTCCCCATGG + Intergenic
1132703446 16:1231425-1231447 AGCCCCAGCCCAGCTCCCCATGG + Intergenic
1132703473 16:1231492-1231514 AGCCCCAGCCCAGCTCCCCATGG + Intergenic
1132705049 16:1239908-1239930 AGGCCCAGCCCAGCTCCCCATGG - Intergenic
1132708030 16:1254875-1254897 AGCCCCAGCCCAGCTCCCCTTGG - Intergenic
1132708057 16:1254942-1254964 AGCCCCAGCCCAGCTCCCCATGG - Intergenic
1132708070 16:1254975-1254997 AGCCCCAGCCCAGCTCCCCATGG - Intergenic
1132708081 16:1255007-1255029 AGCCCCAGCCCAGCTCCCCATGG - Intergenic
1132708104 16:1255072-1255094 AGCCCCAGCCCAGCTCCCCATGG - Intergenic
1132708116 16:1255105-1255127 AGCCCCAGTCCAGCTCCCCATGG - Intergenic
1132708151 16:1255204-1255226 AGCCCCAGCCCAGCTCCCCATGG - Intergenic
1132708162 16:1255237-1255259 AGCCCCAGCCCAGCTCCCCATGG - Intergenic
1132708174 16:1255270-1255292 AGACCCAGCCCAGCTCCCCATGG - Intergenic
1133002636 16:2858783-2858805 TGGCCGAGCCCTGGTGCCCATGG - Intergenic
1133241843 16:4418869-4418891 AGCCTGAGCCCAGCTCTTCAGGG - Intronic
1134089571 16:11384379-11384401 AGCCCCAGCCCTGCTGCCTCAGG + Intronic
1135254082 16:20926615-20926637 AGACCGAGTCCAGCTGCCTGAGG - Intergenic
1135663181 16:24314422-24314444 AGCTCCAGGCCAGCTGCCTAAGG + Intronic
1135759465 16:25125626-25125648 AGTTTGAGACCAGCTGCCCAAGG + Intronic
1136289240 16:29261663-29261685 AGAGCGCGCCCAGCTCCCCACGG - Intergenic
1139429055 16:66901319-66901341 ATTCCCAGCCCTGCTGCCCAGGG - Intergenic
1139719845 16:68843634-68843656 CTCCTGAGCCCCGCTGCCCACGG - Exonic
1140046086 16:71441488-71441510 AGCCCTGTCACAGCTGCCCACGG - Intergenic
1142094975 16:88234620-88234642 AGAGCGCGCCCAGCTCCCCACGG - Intergenic
1142131346 16:88432946-88432968 AGTCCCAGCCATGCTGCCCAGGG + Exonic
1142155525 16:88531221-88531243 AGCCCTGCCCCATCTGCCCATGG - Intronic
1142848417 17:2692923-2692945 GGCCCCGGCCCAGCAGCCCACGG + Intronic
1143019087 17:3907420-3907442 ACCCCGAGCTCACCTGTCCAAGG + Intronic
1143034900 17:3989210-3989232 AAGCCGAGGCCAGCTGCCCTGGG - Intergenic
1143400769 17:6640624-6640646 GGCCCGAGCCCACCTGGCCTAGG + Exonic
1143628787 17:8125476-8125498 AGCCCGAGCCCAGGTTCCCAAGG - Intergenic
1143780421 17:9226103-9226125 AGCCAGAGCCCAGCTCCCGTAGG + Intronic
1144438991 17:15264772-15264794 ACCCAGAGCCCGGCTGGCCAAGG + Intronic
1144660004 17:17061781-17061803 AGCAGGAGCCCAGCAGCCCTTGG + Intronic
1145003683 17:19322902-19322924 AGCCCCAGCTCTGCTGCTCAAGG - Intronic
1146534790 17:33640798-33640820 AGGCTGAGCCCTGCTGCCCCTGG + Intronic
1147179357 17:38674638-38674660 AGCCCGAGCTCTGCGGCCCCGGG - Exonic
1149657254 17:58316728-58316750 TGGCAGAGCCCAGCTGCCCTGGG + Intronic
1149867085 17:60157060-60157082 GGCCCCAGCCCAGCTGCCCCTGG - Intronic
1151705053 17:75763088-75763110 AGGCCGAGCACAGCTTCGCAGGG - Exonic
1152002199 17:77653970-77653992 AGCTCCAGCCCACCTGCCCAAGG + Intergenic
1152018708 17:77769185-77769207 ACCCCCAGCCCTGCTGCCCCTGG - Intergenic
1152378161 17:79929224-79929246 TGGCCGAGCCAAGCTGCCGAAGG + Intergenic
1152494419 17:80660956-80660978 ACCCCCAGCCCAGCTGCCCTTGG + Intronic
1152739437 17:82012557-82012579 GGCCCCAGCACAGCAGCCCAGGG - Intronic
1155347596 18:24874162-24874184 ACCCTGAGCCCAGCTGTGCAAGG - Intergenic
1157578633 18:48760329-48760351 AGCCAGAGACTAGCTGCCCTTGG + Intronic
1157585220 18:48796711-48796733 AGCCAGCCCACAGCTGCCCAGGG + Intronic
1157623117 18:49027298-49027320 AGCCCCAGCCCAGCTCCTGAAGG - Intergenic
1157699831 18:49755105-49755127 AGCTTGAGCTCAGGTGCCCACGG - Intergenic
1160387166 18:78503727-78503749 TGCCCCAGCGCTGCTGCCCATGG + Intergenic
1160592797 18:79953146-79953168 AGCCTGAGCCCAGCAGCCTTTGG + Intergenic
1160878865 19:1310647-1310669 AGAGAGAGACCAGCTGCCCACGG + Intergenic
1161016711 19:1987036-1987058 AGGCCCAGCCCACCTGCCCAGGG + Intronic
1161112351 19:2477367-2477389 GGCCCCAGCCCGGCTGCCCACGG - Intronic
1162124679 19:8493141-8493163 AGTCAGAGCCCTGCTGGCCAAGG + Intronic
1162195244 19:8979637-8979659 AGTTCCAGCACAGCTGCCCACGG - Exonic
1162464466 19:10831694-10831716 AGCCCAAGCCCAGCCACCCTGGG - Exonic
1162744845 19:12792449-12792471 GGCCCAAGCCCAGCTGCGCCGGG - Exonic
1163447790 19:17357736-17357758 AGCCCCAGCCCACTTGCCCCCGG + Intronic
1163499023 19:17664576-17664598 AGCTCTAGTCCATCTGCCCAGGG + Intronic
1164648688 19:29876615-29876637 AGCCCGTCCCCAGGTCCCCAGGG - Intergenic
1165900782 19:39168337-39168359 GGCCCCACCCCAGCTGCCCCGGG - Intronic
1166046944 19:40235381-40235403 TGCCCGAACCCAGCTGCTCCGGG - Intronic
1166663700 19:44664290-44664312 AGCCCGAGCCCAGCAGGTCGAGG - Intronic
1166942276 19:46374172-46374194 AGCCCAGGCCCAGCAGGCCACGG - Intronic
1168266972 19:55228570-55228592 TGCCAGAACCCAGCTTCCCAGGG + Intronic
925444393 2:3915355-3915377 AGCCCAAGCACAGTGGCCCAGGG + Intergenic
925529530 2:4843943-4843965 AGTCTGTGCCCAGCTGCCCTAGG - Intergenic
926104698 2:10142798-10142820 TGCCTGAGCCCAGGTGCCCGCGG + Intronic
929075218 2:38075049-38075071 AGGCCGAGCCCTGCTGCACCAGG + Exonic
932269632 2:70398291-70398313 AGTCCCTCCCCAGCTGCCCAAGG - Intergenic
932624029 2:73284178-73284200 AGGCCAGGCCCAGCGGCCCAGGG + Exonic
932655772 2:73610169-73610191 AGCCCCAGTCCAGCTCCCCCAGG + Intronic
932758752 2:74426175-74426197 ATCCAGAGCCCAACTGCGCATGG + Exonic
935255723 2:101308274-101308296 TGCCCGAGCCCGGCGGCCGAGGG - Exonic
936086527 2:109473307-109473329 AGCCCAGGCACAGCTGCCCATGG - Intronic
941664456 2:168230483-168230505 AGCCCCAGCCAAGCTGACCATGG + Intronic
942063394 2:172248319-172248341 ACTCAGGGCCCAGCTGCCCAGGG - Intergenic
943297825 2:186160859-186160881 AGGCCGAGCCCAGGGCCCCACGG + Intergenic
945188891 2:207166440-207166462 AGCCCGAGCCCAGCCGTCCCGGG - Intronic
946154117 2:217796049-217796071 AGTCCAAGCACAGGTGCCCATGG + Intergenic
946394246 2:219435237-219435259 CCCCCGAGCCCAGCTGCCTGTGG + Exonic
946727155 2:222671894-222671916 AGCCCAAGCCCCGCGGCCCGGGG - Intronic
946865743 2:224039553-224039575 AGCCCGGGCCCAGCTGCACGTGG + Intergenic
947530601 2:230906638-230906660 ATCCCGAGCGCAGCTGATCATGG - Intergenic
947591508 2:231388660-231388682 TGCCTGGGCCCAGCTGTCCAGGG + Intergenic
947597595 2:231423263-231423285 AGGCTCAGGCCAGCTGCCCAGGG - Intergenic
947875149 2:233462749-233462771 AGCCCGAGCCCTGCTGTCCCTGG - Intronic
948223266 2:236290068-236290090 TGTCCGAGCCCAGCTGGGCAGGG + Intergenic
948601823 2:239111759-239111781 ACCCCTAGCCCTGCAGCCCAGGG - Intronic
948740080 2:240040871-240040893 TGTCCCAGCCCAGCTGCCCGGGG + Intergenic
1169291793 20:4359214-4359236 TGCCTGAGCCCTGCTCCCCAGGG + Intergenic
1169893113 20:10474634-10474656 AGCCCCAGCCCAGGCCCCCAAGG - Intronic
1170551430 20:17480745-17480767 GGACTGAGCTCAGCTGCCCACGG - Intronic
1170584356 20:17723161-17723183 AGCCCCACCCCTGCAGCCCATGG + Intronic
1172131540 20:32659322-32659344 AGCCCCAGGCCTCCTGCCCAGGG - Intergenic
1173525864 20:43732031-43732053 AGCCAGAGCCCAAAAGCCCATGG - Intergenic
1174061940 20:47839203-47839225 AGCCCTTCCCCAGCTGTCCAAGG + Intergenic
1174069567 20:47890028-47890050 AGCCCTTCCCCAGCTGCCCAGGG - Intergenic
1176047321 20:63099676-63099698 GGCTGGAGTCCAGCTGCCCAGGG - Intergenic
1176077566 20:63255181-63255203 AGGCAGGACCCAGCTGCCCAGGG + Intronic
1176213688 20:63938608-63938630 AGCGCCAGCCCCGCTGCTCAGGG + Intergenic
1176276921 20:64277939-64277961 ACCCAGTGCCCAGCTGCCCAGGG - Intronic
1176276944 20:64278023-64278045 ACCCAGTGCCCAGCTGCCCAGGG - Intronic
1176276987 20:64278189-64278211 ACCCAGTGCCCAGCTGCCCAGGG - Intronic
1176283392 20:64328032-64328054 CGCGGGAGCCCAGCAGCCCAGGG + Intergenic
1176309282 21:5141247-5141269 AGCCCCAGCCCAGCCCCTCAGGG + Intronic
1178601759 21:34000532-34000554 AGCCCATTCCCAGCTGCCCCTGG - Intergenic
1178610061 21:34072916-34072938 AGCCCGCGCGCCGCGGCCCACGG + Intergenic
1179710798 21:43211896-43211918 AGCCCCTCCCCAGCTCCCCAAGG - Intergenic
1179847780 21:44120786-44120808 AGCCCCAGCCCAGCCCCTCAGGG - Intronic
1179881803 21:44296168-44296190 TGCCCACGGCCAGCTGCCCACGG - Intronic
1180004084 21:45011991-45012013 CGCCCGACCCCAGCTGCCGCAGG + Intergenic
1180046180 21:45306794-45306816 GGCCTGAGCACAGCTGCCCTAGG - Intergenic
1180148914 21:45937730-45937752 AGGCTGAGCCCTGCAGCCCAAGG - Intronic
1180900566 22:19369078-19369100 AGCAAGAGCACAGCTGGCCAGGG + Intronic
1181557751 22:23681526-23681548 AGACCCAGCCCACCTGCCCCTGG - Intergenic
1183066715 22:35368521-35368543 CGACCACGCCCAGCTGCCCAGGG + Intergenic
1183352993 22:37344079-37344101 TGCCCAACCCCACCTGCCCATGG + Intergenic
1183421395 22:37713604-37713626 AGCCAGACCCCAGCTGCCCTGGG - Intronic
1183521538 22:38298578-38298600 TGCCTGGGCCCTGCTGCCCATGG + Intronic
1183578210 22:38706014-38706036 CCCCCGAGCCCAGCTCCCCGGGG + Exonic
1183682556 22:39341622-39341644 ACCCCGTGCCCAAGTGCCCATGG + Intergenic
1183830731 22:40417278-40417300 AGCCTCAGCCCAGCAGCCTAGGG + Intronic
1183938703 22:41280172-41280194 AGCACGCTCCCAGCTACCCAAGG + Intronic
1183951893 22:41357054-41357076 AGCTGGGACCCAGCTGCCCAGGG + Intronic
1184339570 22:43878929-43878951 ATCCCGAACCCAGCTGCTGAGGG + Intergenic
1184415788 22:44351065-44351087 CCCCCCAGCCCACCTGCCCAGGG + Intergenic
1184429032 22:44430449-44430471 AGCCAGGGTCCCGCTGCCCATGG + Intergenic
1184617464 22:45647733-45647755 AGCCCCAGCTCAGGTGCACAAGG - Intergenic
1184890550 22:47376376-47376398 AGCCCCTGCCCTGCAGCCCAGGG + Intergenic
1185028000 22:48426503-48426525 AGCACGAGGCCATCTGTCCATGG + Intergenic
950005711 3:9689793-9689815 AGACCCAGCCCTGCTGCCCATGG + Intronic
950535876 3:13577814-13577836 GGCCTGAACCCAGCTGCCCCCGG - Intronic
954093186 3:48301431-48301453 ACCCCGAGCAGGGCTGCCCAGGG - Intronic
955217773 3:56998587-56998609 AGCCCGAGCCCTCCTGCCCAGGG + Intronic
955484570 3:59422982-59423004 TGCCCCAGCCCCACTGCCCAGGG + Intergenic
956484587 3:69708897-69708919 AGGCCCAGCCCACCTGCCTAAGG + Intergenic
956731671 3:72202076-72202098 TGCCAGAGCCCAGCTTCCAATGG + Intergenic
960840088 3:121948883-121948905 AGCTCGAGCCCAGCAGCTCAAGG + Intergenic
961257278 3:125566866-125566888 ATCCCGAGCCCAGGAGTCCAAGG - Intronic
961379483 3:126487755-126487777 GCCCCCAGCCCAGCTGCCCTGGG + Intronic
961385323 3:126520094-126520116 AGCCCCTCCCCACCTGCCCAGGG + Intergenic
961745638 3:129062082-129062104 AGCCCCAGCCTCGCTGCCCATGG + Exonic
966880162 3:184345494-184345516 AGCACGAGCCCAGCTGGGCAGGG - Intronic
968522307 4:1039558-1039580 AGGCTGAGGGCAGCTGCCCAGGG - Intergenic
968712300 4:2127646-2127668 AACCCGAGCCCATCTGCCTCTGG + Intronic
971669802 4:29542551-29542573 AGCCCAATCCTGGCTGCCCATGG - Intergenic
975579206 4:75891790-75891812 CACCCGAGCCCTGCTGCCCAAGG + Intronic
976744584 4:88390683-88390705 TCCCCAAGCCCAGCTGCCCATGG - Exonic
978162408 4:105564865-105564887 ATCCCGAGAACATCTGCCCAAGG + Intronic
982257709 4:153466527-153466549 AGAGCGAGCCCAGCGGCGCAAGG - Intronic
985762526 5:1757618-1757640 GGCCCCTGCCCAGCTGCCCCGGG + Intergenic
986273355 5:6253216-6253238 AGCCCTGTCCCACCTGCCCAGGG - Intergenic
986485433 5:8231457-8231479 AGACTGAGCCCAGCTCTCCAGGG - Intergenic
992629825 5:78669345-78669367 TGCCCGAGCCCAGGAGGCCAAGG + Intronic
997381943 5:133444606-133444628 AGCCAGGGCCCAGCAGCTCAAGG - Intronic
998200459 5:140114241-140114263 AGCCCGAGCCGGGGTGCCCCAGG - Exonic
999445300 5:151634016-151634038 AGCCCCAGCCCAACTTTCCATGG + Intergenic
1002326907 5:178415704-178415726 TGCCCGAGCCCTGCTGCACAAGG + Intronic
1003330501 6:5124730-5124752 AGTCTGAGCCCTGCTGGCCAAGG - Intronic
1003860109 6:10315177-10315199 AGCCAGGTCCCAGCTGCTCAGGG - Intergenic
1004392771 6:15223226-15223248 AACCCCAGCCCAGCTGGGCACGG - Intergenic
1006183687 6:32168657-32168679 TGCCCTTGCCCAGATGCCCAGGG - Exonic
1007118652 6:39362387-39362409 AGTCCGAGCCCAGCCTCCCAGGG - Intronic
1007227321 6:40324366-40324388 AAGCAGAGCCCAGCTCCCCAGGG + Intergenic
1007405802 6:41635551-41635573 AGCCCAGGCCCAGCTTCCCCGGG - Intergenic
1008038674 6:46774234-46774256 AGCCCGGTCACAGATGCCCAGGG + Intergenic
1008294576 6:49760234-49760256 AGCCCTAGTCAAGCTGCCAAGGG - Intergenic
1008964276 6:57298525-57298547 GCCCCGAGCCCTGCTTCCCAGGG - Intergenic
1014268761 6:119312684-119312706 AGCCTGAGGCCAGCTGCCTCAGG + Intronic
1015880649 6:137867370-137867392 AGCCCGACCCCAGGCGTCCATGG + Exonic
1016777575 6:147921734-147921756 AGCCAGAGCCCAGCACCCCCTGG + Intergenic
1018031534 6:159845385-159845407 GGCTCCAGCCCAGCTGCCCTTGG + Intergenic
1018614541 6:165674391-165674413 CGCCACATCCCAGCTGCCCATGG + Intronic
1018824364 6:167398069-167398091 AGCCTGGGCCCAGGTGCGCACGG - Intergenic
1019492451 7:1321725-1321747 AGGCCTTGACCAGCTGCCCAAGG - Intergenic
1019528587 7:1492807-1492829 AGCCCGCGCCCCACTCCCCATGG - Intronic
1019997939 7:4736976-4736998 AGCCAGAGCCCATCTGACCTTGG - Intronic
1020034921 7:4959028-4959050 AGCCCGGGGCCAGATTCCCATGG - Exonic
1020224456 7:6269118-6269140 AGCCGGAAGCCAGCTGACCAAGG + Intronic
1023122788 7:36926141-36926163 AGGAAGATCCCAGCTGCCCAAGG + Intronic
1023344740 7:39259846-39259868 AGACAGAGCCCAGACGCCCAGGG + Intronic
1023490048 7:40730002-40730024 GGACCGAGCCAAGCAGCCCAAGG - Intronic
1024555906 7:50603531-50603553 AGCCCCAGCCAAGCTGGCCCAGG + Intronic
1025232518 7:57211961-57211983 GGCCCTTCCCCAGCTGCCCAGGG - Intergenic
1027229488 7:76263948-76263970 AGCCCTAGGCCAGCTCACCAGGG - Intronic
1029741107 7:102492237-102492259 AGCCCGCTCTCACCTGCCCAGGG + Intronic
1029759099 7:102591407-102591429 AGCCCGCTCTCACCTGCCCAGGG + Intronic
1029968408 7:104764487-104764509 ATCCCAAGCCCAGATTCCCATGG + Intronic
1032841233 7:135714901-135714923 AGCCCGAGGCCTGCAGCGCAGGG + Intronic
1033129536 7:138733991-138734013 GGCTCAAGCCCAGATGCCCAGGG + Intronic
1033275631 7:139969711-139969733 AGCCCGACCCCAGCAGACCTGGG - Intronic
1034487080 7:151372777-151372799 AGCTCCAGCCCCGCTGCACAGGG - Intronic
1034503236 7:151465334-151465356 GGCCCCCGTCCAGCTGCCCAAGG - Intergenic
1035263329 7:157675216-157675238 AGCGGGAACCCTGCTGCCCATGG - Intronic
1035412594 7:158657344-158657366 AGCCAAAGCCCAGGTGCTCAGGG + Intronic
1035458168 7:159023072-159023094 ATCCTGACCCTAGCTGCCCAGGG - Intergenic
1037596731 8:20360612-20360634 AGCCTGACAGCAGCTGCCCAGGG - Intergenic
1037912464 8:22751978-22752000 TGCCTGAGCCCAGCAGGCCAAGG - Intronic
1039525309 8:38209246-38209268 ACCCCCAGTCCAGCAGCCCAAGG + Exonic
1039785702 8:40832566-40832588 GCCCCGAGCCCAGCTGCCCTTGG + Intronic
1040902153 8:52428167-52428189 AGCCTCCGCCCAGCTGCCTAAGG - Intronic
1042228783 8:66536526-66536548 TGCCCAAGCCCAGCTCCCCTGGG - Intergenic
1042352734 8:67794169-67794191 AGCCCAAGCCCACCTCCTCAAGG - Intergenic
1044569432 8:93700679-93700701 AGCCCGAGCCCAGCTGCCCAGGG + Intronic
1047767492 8:128001458-128001480 TACCGGTGCCCAGCTGCCCAAGG + Intergenic
1049201686 8:141343543-141343565 ATCCCTGGGCCAGCTGCCCAGGG + Intergenic
1049241462 8:141539431-141539453 AGCCCGAGCCCAGCCTCCTCAGG - Intergenic
1049253062 8:141599350-141599372 AGACCGACCCCCTCTGCCCAGGG - Intergenic
1049572748 8:143377326-143377348 AGGCCAAACCCTGCTGCCCACGG - Intronic
1049594224 8:143476058-143476080 AGCCTCAGCCCAGGTGCCAAGGG - Intronic
1049646688 8:143738828-143738850 AACCTGAGCCCAGCTGGCCATGG + Intergenic
1049751935 8:144289037-144289059 AGCCCAAGGCCACCTGCACATGG + Intronic
1049998632 9:1053013-1053035 AGCCCAGGACCAGGTGCCCATGG - Intronic
1056732351 9:89177645-89177667 GGCCGGACCCCCGCTGCCCAGGG + Intronic
1056826424 9:89879325-89879347 AGGCCCAGCACAGCTGTCCAGGG + Intergenic
1056919627 9:90774603-90774625 CGCCCCAGCCCAGCTGCTCATGG - Intergenic
1057548529 9:96035338-96035360 AGCCCGCCCCTGGCTGCCCATGG + Intergenic
1058886743 9:109327386-109327408 AGCAGCAGCCCAGCTGCCAAGGG - Intergenic
1059421643 9:114196108-114196130 AGCCCCAGCCCAGCTCCCCTGGG + Intronic
1060300805 9:122373630-122373652 AGCCCCAGGCCAGCTGACCCGGG + Intronic
1060404656 9:123367383-123367405 AGCCCATGTCCAGATGCCCAGGG + Intronic
1060722186 9:125986615-125986637 AGTCCGAGCCCACCTGACCATGG - Intergenic
1061728759 9:132597143-132597165 AGCCCCAGCCCAGCTGTCAGGGG - Intronic
1061819378 9:133217649-133217671 AGCCCCAGCCCACCTGCCTTGGG + Intergenic
1061885642 9:133589936-133589958 AGTCCCAGCTCAGCTGCCGACGG + Intergenic
1062228220 9:135465807-135465829 AGCCTGAGCCCAGCTGCCCATGG + Intergenic
1062469495 9:136696358-136696380 AGACCAAGCCCAGAAGCCCACGG + Intergenic
1189818360 X:44846252-44846274 AGCCAGAGCCCAGGTATCCAGGG - Intergenic
1190324384 X:49197839-49197861 ATCCCCATCCCTGCTGCCCAAGG - Exonic
1192503782 X:71668927-71668949 AGCCCAAGCACAGCAGCCCTGGG + Intergenic
1192522544 X:71814979-71815001 AGCCCAAGCACAGCAGCCCTGGG + Intergenic
1194758342 X:97764098-97764120 TGCCCCAGCTCAGTTGCCCAGGG - Intergenic
1195352657 X:104009516-104009538 AGCCCCCACCCCGCTGCCCAGGG + Intergenic
1195356436 X:104044046-104044068 AGCCCCCACCCGGCTGCCCAGGG - Intergenic
1200062651 X:153490453-153490475 AGCACCAGCTCAGCTGCCCCAGG + Intronic
1200073363 X:153539614-153539636 GGCGTGAGCCCAGCTGCCCAGGG + Intronic