ID: 1044569437

View in Genome Browser
Species Human (GRCh38)
Location 8:93700692-93700714
Sequence CTGCCCAGGGCCGCCCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 344}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044569430_1044569437 -2 Left 1044569430 8:93700671-93700693 CCGGTAACAGCCCGAGCCCAGCT 0: 1
1: 0
2: 1
3: 2
4: 121
Right 1044569437 8:93700692-93700714 CTGCCCAGGGCCGCCCACACTGG 0: 1
1: 1
2: 1
3: 32
4: 344
1044569428_1044569437 8 Left 1044569428 8:93700661-93700683 CCCTGGAAAACCGGTAACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1044569437 8:93700692-93700714 CTGCCCAGGGCCGCCCACACTGG 0: 1
1: 1
2: 1
3: 32
4: 344
1044569429_1044569437 7 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569437 8:93700692-93700714 CTGCCCAGGGCCGCCCACACTGG 0: 1
1: 1
2: 1
3: 32
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044569437 Original CRISPR CTGCCCAGGGCCGCCCACAC TGG Intronic
900387870 1:2418872-2418894 CTGCCCACCTCAGCCCACACTGG + Intergenic
900392291 1:2438928-2438950 CTGGGCAGGGCAGCCCACGCCGG - Intronic
901634449 1:10664159-10664181 CTGCGCAGGGCTCCCCGCACGGG + Intronic
901938971 1:12647384-12647406 CTCCCCAGGGCCGTGCACAGTGG - Intronic
902545080 1:17185010-17185032 CTGCCCAAGGTCACCAACACTGG - Intergenic
902615021 1:17619004-17619026 CTGCTCAGGCCCGCCCGCTCTGG - Intronic
903124858 1:21240745-21240767 CTGGCCGAGGCCGACCACACAGG + Intronic
903353789 1:22734074-22734096 CTGCCCTGGGCCTCCCACCCAGG + Intronic
903554066 1:24180625-24180647 CTAGCCAGTGCTGCCCACACTGG + Intronic
903658509 1:24963278-24963300 CTGCCCCGAGCCGGCCACCCAGG + Intronic
903750472 1:25617687-25617709 CTGCCCAGGGACCCCCATCCCGG + Exonic
904468629 1:30722530-30722552 CTGCCCAGGGCCCCACAGAGTGG - Intronic
904585875 1:31580334-31580356 GCCCCCAGGGCTGCCCACACAGG - Intronic
905209750 1:36365998-36366020 AGGCCCAGGGCCGCCGACCCTGG - Intronic
905485391 1:38292435-38292457 CTGCCCAGGGCTCCCCAGGCTGG - Intergenic
906196155 1:43931939-43931961 CTGCCTAAGGCCGGCCACAGTGG - Intergenic
906616834 1:47239186-47239208 CTGCTCAGGGCCAGGCACACAGG + Intergenic
908763778 1:67536254-67536276 CTGCCCACCGCCACCCACCCAGG - Intergenic
913647034 1:120867478-120867500 CTGTGCAGGTCCGCCTACACTGG + Intergenic
914079608 1:144395387-144395409 CTGTGCAGGTCCGCCTACACTGG - Intergenic
914174508 1:145263928-145263950 CTGTGCAGGTCCGCCTACACTGG - Intergenic
914461577 1:147890424-147890446 CTGTCCTGGGCTGCCCAGACAGG + Intergenic
920204841 1:204283904-204283926 CTGCCCAGCACCTCACACACAGG + Intronic
920533578 1:206722894-206722916 CAGGCCAGGGCCACCCACTCTGG - Intronic
920789204 1:209072419-209072441 CTGCCCACGGCCTCCCGCCCAGG + Intergenic
922057858 1:222058488-222058510 CTGCCCAGAGCTGCACACAGAGG + Intergenic
922717395 1:227884671-227884693 CAGCCCAGGGCACCCCAGACTGG - Intergenic
923468960 1:234273330-234273352 CTGCCCAGAAGGGCCCACACCGG + Intronic
924472255 1:244352713-244352735 CTGCCCACGGCAGCCCAAGCAGG + Exonic
924944901 1:248839343-248839365 CTGCCCAGGGCCGGGCACAGTGG + Intronic
1062813362 10:481828-481850 CTGCCCCGGCCCACCCCCACAGG + Intronic
1062927681 10:1329108-1329130 CTGCCACAGGCTGCCCACACTGG - Intronic
1066613616 10:37275583-37275605 CTGCCCAGGGCCGGCAGCACTGG + Intronic
1067090430 10:43263636-43263658 CTGCCCAGGGCAGCCAGCAGGGG - Intronic
1067796711 10:49326499-49326521 CTCCCCAGAGCCGCCCCCACCGG + Exonic
1069615216 10:69802458-69802480 CTCCCCAGGGCCGCGGGCACCGG - Exonic
1070833699 10:79435378-79435400 CTGCCCACGGACGGCCCCACAGG + Intronic
1072662833 10:97373120-97373142 CTGCCACGGGCTGCCCATACAGG + Exonic
1073251003 10:102120243-102120265 CAGCCAGGGGCCGCCCGCACCGG - Exonic
1073435773 10:103514805-103514827 ATGCCCAGGGCCACCGACAGGGG + Intronic
1074078953 10:110152464-110152486 TGTCCCAGGGCCGCCCTCACAGG - Intergenic
1074156836 10:110807229-110807251 CAGCCCAGGGGCCCCCTCACTGG + Intronic
1074528548 10:114281143-114281165 CCACCCTGGGCTGCCCACACAGG - Intronic
1075885503 10:125896239-125896261 CGGCCCTGGGCCGCCCTCCCGGG - Intronic
1076513948 10:131032817-131032839 GTGCCCTGAGCCGCACACACCGG - Intergenic
1076563460 10:131382318-131382340 CTGCCCAGGAAGACCCACACTGG - Intergenic
1076676984 10:132152192-132152214 CTGCACAGGGTCTCCCACAGGGG - Intronic
1076722302 10:132397950-132397972 CTGCCCTGCGCCCCCCACCCAGG - Intronic
1077111526 11:864200-864222 CAGCCCAGGGCCCCACACTCAGG + Intronic
1077184694 11:1230841-1230863 CTGCCCAGGGGCCCCCACTGGGG - Intronic
1077196183 11:1281537-1281559 CTGCCCAGAGACCCCCGCACAGG - Intronic
1079099989 11:17535066-17535088 CAGGCCTGGGCTGCCCACACTGG + Intronic
1079586367 11:22130229-22130251 CTGGGCAGGGCCTCCCAAACTGG + Intergenic
1081688526 11:45059247-45059269 CTGACCTGGGCCACGCACACAGG + Intergenic
1081993170 11:47348283-47348305 GTGCCCAGTGCTGCACACACAGG - Intronic
1082803660 11:57432643-57432665 GTGCCCGGGGCAGCCCACCCAGG - Intergenic
1083301878 11:61743923-61743945 CTGCCCAGGGCCGCCTCCAGGGG - Exonic
1083752429 11:64767809-64767831 CCACCCAGAGCCGCCCACCCTGG - Exonic
1084083400 11:66843516-66843538 CCGCCCAGCGCCGCCGACTCGGG - Exonic
1084261195 11:67979910-67979932 CTGCCAAGGCCCTCCAACACAGG + Intergenic
1084680421 11:70663317-70663339 CTCCCCAGGGCCCCCCAATCCGG - Intronic
1084797574 11:71518878-71518900 CTGCCCTGTGCCACCCCCACGGG - Intronic
1085040829 11:73325318-73325340 CAGCCCAGGCCTGGCCACACAGG - Intronic
1085079913 11:73625453-73625475 CAGCCCAGGGCCGGGCACAGTGG + Intergenic
1085295479 11:75429333-75429355 CTGCCCAGAGCCTCCCAGTCTGG + Intronic
1085450403 11:76628799-76628821 CAGCCCAGGGCCTGACACACAGG - Intergenic
1086926293 11:92644076-92644098 CTGCCCTGGGCTGCCCTCGCAGG - Intronic
1087682356 11:101231594-101231616 CTGCCCAGGGCTGGCAGCACTGG + Intergenic
1091312730 11:134586077-134586099 TTGGCCAGGGCCTCCCACCCAGG + Intergenic
1091634314 12:2185784-2185806 CTGCCCAGGGCCACACAGACAGG - Intronic
1091782594 12:3223328-3223350 CTGCCCAGGGCTGGCCATGCTGG - Intronic
1091822120 12:3483244-3483266 CTGCCTAGGGCCTCGCAGACGGG - Intronic
1092196694 12:6554242-6554264 GTTCCCAGGCCCGCCCACAAGGG + Intronic
1095943815 12:47742419-47742441 CTTCCCAGGGCAGGGCACACAGG + Intronic
1097270105 12:57768849-57768871 CTGCCCAGGGCAGAACCCACTGG - Exonic
1098526113 12:71488946-71488968 CTGTCCAGGGATGCCCACAGAGG + Intronic
1101489830 12:105200436-105200458 AGGCCAAGGGCTGCCCACACAGG + Intronic
1101962084 12:109258231-109258253 CTGCCCAGGGCCTGGCTCACTGG + Intronic
1102206447 12:111094285-111094307 GTGGCCAGGGCTGCTCACACCGG - Intronic
1103949764 12:124544391-124544413 CTGCCCCGGGCTGCCCGCCCAGG + Intronic
1104344485 12:127983483-127983505 CTGCCCGGGGCCGCCAGCGCCGG - Intergenic
1104597700 12:130131371-130131393 CTGGCAAGGGCCTCCCAGACAGG + Intergenic
1104840915 12:131825192-131825214 CTGCCCTGGGCTGACAACACTGG - Intergenic
1104866730 12:131960387-131960409 GTGCCCAGGGTGGGCCACACGGG - Intronic
1104963421 12:132498665-132498687 CTGCACAGGGCCCCCCATCCTGG + Intronic
1105014255 12:132776529-132776551 GTGCCCAGCGCCTCACACACAGG + Intronic
1105014272 12:132776608-132776630 GTGCCCAGCGCCTCACACACAGG + Intronic
1105219085 13:18308977-18308999 GTGACCAGTGCTGCCCACACTGG + Intergenic
1106402647 13:29444717-29444739 CTGCCCAGGGCCCCCCATGATGG - Intronic
1112238893 13:97661455-97661477 GTTCCCAGGGGCACCCACACTGG + Intergenic
1113866902 13:113532414-113532436 CTGCCCCAGCCCACCCACACAGG - Intronic
1114527430 14:23375603-23375625 CTGACAAGTGCCGCCCCCACAGG + Exonic
1114650946 14:24284354-24284376 CTGCCCAGTGCTGAGCACACAGG + Intergenic
1117082581 14:52166848-52166870 CTGCCCAGGGCCGGCAGCGCTGG - Intergenic
1117097549 14:52314086-52314108 CTGCCCAGTGCCGCGCCCAGCGG + Intergenic
1121031984 14:90666080-90666102 CTCCCCAGGGCTGCACACAGTGG + Intronic
1121114301 14:91332605-91332627 GTGGCCAGGTCCGCCCAGACAGG - Intronic
1121713487 14:96056305-96056327 CTGCCCAGGGCGGCCTGCAAGGG + Intronic
1122378675 14:101286290-101286312 GGGCCCAGGGATGCCCACACAGG - Intergenic
1122628882 14:103098393-103098415 CTGCCCCTGGCCGCGCACTCAGG - Intergenic
1122781513 14:104145803-104145825 TTGCTCAGGGCAGCCCCCACAGG - Intronic
1122814409 14:104305392-104305414 CTAGACAGGGCCGCCCACATGGG + Intergenic
1123033810 14:105463677-105463699 CAGCCCTGGGCCGCCCTCCCGGG - Intronic
1202872556 14_GL000225v1_random:177678-177700 CGGCCCTGGGCCGCCCTCCCGGG + Intergenic
1123699377 15:22903246-22903268 CTGCCCTGGGCTCCGCACACCGG - Intronic
1127916437 15:63459187-63459209 CTGCCCAGGGCCAGCAGCACCGG - Intergenic
1128312149 15:66637465-66637487 TTGCCCAGGGCTGCCCAGCCAGG - Intronic
1128543333 15:68551636-68551658 CTGCCCAGGGTCCCTCACAGGGG - Intergenic
1128724388 15:69977070-69977092 GTGCCCAGTGCCTCCAACACTGG - Intergenic
1129061868 15:72866951-72866973 CTGCCCAGTGCTGGCCACTCTGG + Intergenic
1129069070 15:72936227-72936249 CTGACCAGGCCCACCCACAAGGG - Intergenic
1129293674 15:74587587-74587609 CTCCCCAGGTCCCCTCACACAGG - Intronic
1129761425 15:78131290-78131312 CTGCCGAGGGCCGCGGGCACGGG - Exonic
1130933202 15:88447353-88447375 CTGCCCAGGTCCAACCACCCTGG + Intergenic
1131378681 15:91946317-91946339 CTGCCCAGGGCTGATCTCACTGG - Intronic
1132562839 16:606125-606147 CAGCCCAGGGAAACCCACACTGG - Intronic
1132562851 16:606191-606213 CAGCCCAGGGAAACCCACACTGG - Intronic
1132562863 16:606257-606279 CAGCCCAGGGAAACCCACACTGG - Intronic
1132562875 16:606323-606345 CAGCCCAGGGAAACCCACACTGG - Intronic
1132562887 16:606389-606411 CAGCCCAGGGAAACCCACACTGG - Intronic
1132562909 16:606521-606543 CAGCCCAGGGAAACCCACACTGG - Intronic
1135716857 16:24778187-24778209 CTGCCCAAGGTCACACACACTGG - Intronic
1136418121 16:30115735-30115757 ATGCCCAAGGCTGCCCAGACTGG - Intronic
1139513326 16:67439543-67439565 CTGCCCACAGCCTCCCACCCAGG + Intronic
1141672935 16:85502346-85502368 GTGCTCAGGGCGGCACACACAGG - Intergenic
1141735039 16:85846737-85846759 CAGACCAGGGCCGGACACACAGG - Intergenic
1142093515 16:88227415-88227437 CTGGCCTGGGAGGCCCACACCGG + Intergenic
1142143460 16:88482908-88482930 CTGCTCAGGGCCGACCCCAGAGG + Intronic
1142195200 16:88736434-88736456 CTGCCCAGCGCACCCCACCCAGG + Intronic
1142195217 16:88736495-88736517 CTGCCCAGCGCACCCCACCCAGG + Intronic
1142195234 16:88736556-88736578 CTGCCCAGCGCACCCCACCCAGG + Intronic
1142214453 16:88823833-88823855 ATGCCCAGGACGGCCCTCACAGG + Intronic
1142682809 17:1560419-1560441 CCGCCCAGGGATGCACACACGGG + Intronic
1142863590 17:2777520-2777542 CTGCCCTGGACCCCCCACTCAGG - Intronic
1142957465 17:3531528-3531550 CTCCCCCGGGCCGGCCACAGCGG + Intronic
1143524202 17:7462915-7462937 CAGCCCACTGCCCCCCACACTGG + Exonic
1145061985 17:19739299-19739321 TTGCCCAGGGCCCTGCACACAGG - Intronic
1145204670 17:20976798-20976820 GTGCCCAGGGTCACACACACAGG + Intergenic
1145317613 17:21744258-21744280 TTGCCCAGGGCCGCTCAGATGGG - Intergenic
1145780326 17:27558820-27558842 CTGCCCAGGGCTGCCCCCTGAGG + Intronic
1146398835 17:32488022-32488044 CTCCGCAGGGACGCCCAAACGGG + Exonic
1147612391 17:41809675-41809697 CTGCCCAAGCCAGCCCACCCAGG + Intronic
1148848367 17:50541951-50541973 GAGCCCAGGGGCGCCCCCACAGG - Exonic
1148909814 17:50935367-50935389 CTGCAGAGAGCCGCCCACAGTGG - Intergenic
1150285885 17:63953956-63953978 CTGCCCAGGGCCAGGCAGACTGG - Intronic
1150610353 17:66728318-66728340 CTGCCCTGGACCCCACACACCGG + Intronic
1150834426 17:68551821-68551843 CTTCCCAGGGCCACCCCAACTGG + Intronic
1152325111 17:79631543-79631565 CCGGCCAGGGCTGACCACACGGG + Intergenic
1152424913 17:80213681-80213703 CAGCACAGGGCCTGCCACACTGG + Intronic
1152791556 17:82282952-82282974 CTGCGCAGGGCTGGGCACACCGG + Intergenic
1154437287 18:14356907-14356929 CTGCACAGGGCCCCCCACCCAGG - Intergenic
1155148755 18:23105780-23105802 CTGCACAGGGGCGTCCACGCTGG - Intergenic
1156629066 18:38944661-38944683 CTGCCCAGTGCCGGCGACACAGG + Intergenic
1157607088 18:48932724-48932746 CAGGCCAGGGCCTCACACACAGG + Intronic
1158579854 18:58671677-58671699 CCGCCCTCGGCCGCCCCCACGGG + Exonic
1160336205 18:78042685-78042707 CTGCCCTGGGATGCCCACTCTGG - Intergenic
1160502967 18:79411329-79411351 CTGCCCAGGTCCTCCCCGACGGG - Exonic
1160510629 18:79451619-79451641 GTGCCCCAGGCCGCCCACTCAGG + Intronic
1160527807 18:79547679-79547701 CTGCTCAGGGCCGCCTCCGCTGG - Intergenic
1160568441 18:79800682-79800704 CTGCTCAGCGCCGCCCGCCCGGG - Intergenic
1160754797 19:751576-751598 CTGCCCAGAGCCTCCCAGTCAGG - Intronic
1160774412 19:848427-848449 CTGCCCAGGGCCACCCTGATGGG - Intergenic
1160916981 19:1501480-1501502 CTGCCCAGGTCAGCACACCCAGG + Intergenic
1161439111 19:4280335-4280357 CTCCCCGGGGCCGCCCAGAAGGG - Exonic
1161567619 19:5012432-5012454 TGTCCCAGGGCCCCCCACACCGG + Intronic
1161582148 19:5086870-5086892 CAGCCCAGGTCTGCCCCCACAGG + Intronic
1162140978 19:8585463-8585485 CAGTCGAGGGCCGCCCACTCCGG + Exonic
1163526497 19:17824663-17824685 CTGCCCTGGGGCCCCCACAGTGG + Intergenic
1163715256 19:18869376-18869398 CTCCCCAGGTGCGCCCACCCGGG - Exonic
1163717112 19:18879113-18879135 CTGTCCCGGGCCCTCCACACGGG + Intronic
1163724146 19:18913083-18913105 AGGCCCAGCGCAGCCCACACAGG + Intronic
1163727774 19:18932362-18932384 CAGCCCAGCGCCACCCACCCTGG - Intronic
1164208303 19:23075588-23075610 CTGCCCAGGGAGGTCCAGACAGG - Intronic
1164325497 19:24187795-24187817 CTGCCTGGGGCCGTCCACAGTGG - Intergenic
1164609420 19:29622125-29622147 CTGCCCTGGGCAAGCCACACGGG - Intergenic
1164730889 19:30503699-30503721 CTGCCCAGGGACTCCCACGAGGG - Intronic
1164840863 19:31391202-31391224 CGTCCCAGGGCCTCCCACCCTGG - Intergenic
1165246305 19:34500322-34500344 CTGACCAGGGCCACCCACGCGGG - Exonic
1165769190 19:38368462-38368484 CTGCCCAGAGCTGTCCACTCTGG - Intronic
1165940930 19:39414346-39414368 CTGCCCAGCGCTGCCCCCTCTGG - Intronic
1167386284 19:49166053-49166075 CGGTCCGGGGGCGCCCACACTGG - Exonic
1167593591 19:50416719-50416741 GTGGCCAGGGCCGCTCACCCTGG - Exonic
1167761539 19:51452987-51453009 CGGCTCAGGGCCTCACACACGGG - Intronic
925683086 2:6443926-6443948 CTGCCCAGGGGTGGCCACGCTGG + Intergenic
926201473 2:10802724-10802746 CTGACCAGGGCCCTTCACACAGG + Intronic
926272236 2:11375394-11375416 CTGCCCAGGCCTGGCCTCACTGG - Intergenic
927561352 2:24076534-24076556 CTGCTCAGGGCCTCCCCGACCGG - Intronic
928077814 2:28281167-28281189 CTCCCCTGGGCTGCCCCCACCGG + Intronic
928186569 2:29115726-29115748 GCCCCCAGGGCCGCCCACCCCGG - Intronic
928257071 2:29731987-29732009 TTGCCCTGGGCCTCGCACACTGG + Intronic
932500750 2:72180710-72180732 CTGCAAAGGGCCACCCACAGTGG - Intronic
933658240 2:84906212-84906234 GTGGCCGGGGCCGCCCACACCGG - Intronic
934184972 2:89663536-89663558 GTGACCAGTGCTGCCCACACTGG - Intergenic
934295240 2:91737659-91737681 GTGACCAGTGCTGCCCACACTGG - Intergenic
934553770 2:95277028-95277050 CTGCCCACGGCCGCCAGCAAGGG - Exonic
934967017 2:98731587-98731609 CCGCTCCGGGCCGCCCAAACTGG + Intergenic
934975790 2:98801226-98801248 CTGTCCAGGGCCACCCTCATTGG + Intronic
935130574 2:100258158-100258180 CCGCCCAGGGCCGCCGAGTCTGG - Intergenic
937332907 2:121043249-121043271 CTGCCCAGGGCCGGCCCCTCTGG - Intergenic
939886441 2:147686510-147686532 CTGCCCAGGGCCCGCGGCACCGG + Intergenic
941486030 2:166084033-166084055 CAGCCCTGGGAGGCCCACACTGG - Intronic
945869136 2:215207975-215207997 CTGCCCGGGGCCGGCGGCACTGG - Intergenic
946114127 2:217446769-217446791 CTGCCCAGAGCCACCTCCACAGG - Intronic
946152782 2:217787524-217787546 CTGCCCAGGGCCAGCGGCACTGG + Intergenic
948393233 2:237627319-237627341 ATGCCCAGGGCCGGGCACGCGGG - Intergenic
948752476 2:240140430-240140452 TTCCCCAGGGCTGCCCACACTGG - Exonic
948860345 2:240749904-240749926 CTGCTCAGGGCAGCCCTCCCTGG - Intronic
948860919 2:240752273-240752295 CTGCCCTGGGCCACCCACCCAGG + Intronic
948861101 2:240752932-240752954 CTGTCCAGGGCCACCCAGACAGG + Intronic
948933060 2:241144594-241144616 CCACCCAGGTCCTCCCACACTGG + Intronic
1171452972 20:25248607-25248629 CTGCGCAGGGCCGCGGCCACGGG + Intronic
1172126200 20:32626758-32626780 GTCCCCAGGGCCTCCCCCACAGG + Intergenic
1172284704 20:33732301-33732323 CCGCCCAAGGCCGCCCAGGCTGG - Intronic
1172624335 20:36338632-36338654 CGGCCCAGGGCCTTGCACACAGG - Intronic
1175100513 20:56575731-56575753 CTGTCCAGGGCCTTCCACATTGG + Intergenic
1175723330 20:61300644-61300666 CTGCCCTGTTCTGCCCACACAGG + Intronic
1175970518 20:62684557-62684579 CAGCACAGGGCCGGCCACCCTGG + Intronic
1176150605 20:63588958-63588980 CTGCCCTGAGCAGCCCACCCGGG + Exonic
1176173045 20:63704855-63704877 CTGCCCAGGGCAGCCCACACTGG + Intronic
1176249847 20:64115357-64115379 CTGCCCTGGGCTGAGCACACTGG - Intergenic
1176604821 21:8820190-8820212 CTGCCCAGGGGCGGCTGCACCGG + Intergenic
1176839765 21:13828731-13828753 CTGCACAGGGCCCCCCACCCAGG + Intergenic
1176882419 21:14213681-14213703 CTGCACAGGGCCGGGCACAGTGG + Intergenic
1179924488 21:44526807-44526829 CTGCCCAGAGCAGCCCTGACAGG + Intronic
1180043717 21:45293265-45293287 GCTCCCAGGGCCGCCCCCACGGG - Intergenic
1180285543 22:10741798-10741820 CGGCCCTGGGCCGCCCTCCCGGG - Intergenic
1180347111 22:11711795-11711817 CTGCCCAGGGGCGGCTGCACCGG + Intergenic
1180354861 22:11829885-11829907 CTGCCCAGGGGCGGCTGCACCGG + Intergenic
1180383390 22:12162446-12162468 CTGCCCAGGGGCGGCTGCACCGG - Intergenic
1180816680 22:18793833-18793855 GTGACCAGTGCTGCCCACACTGG + Intergenic
1181028909 22:20140706-20140728 CTGCCCAGGCCGGGCCTCACCGG - Exonic
1181202871 22:21228180-21228202 GTGACCAGTGCTGCCCACACTGG + Intergenic
1181463450 22:23098465-23098487 CTGCCCATGGCTGCCCACCATGG - Intronic
1181518508 22:23432113-23432135 CTGCCCAAGGCCACACGCACAGG - Intergenic
1183245228 22:36688144-36688166 CAGCCCAGGGCCCAGCACACAGG + Intronic
1183335738 22:37244864-37244886 CCACCCAGGGACTCCCACACAGG - Intergenic
1183469169 22:37996593-37996615 CTGCACAGGGCTGGGCACACAGG - Intronic
1184229645 22:43151719-43151741 CTGCCCCGGGTCGCCCCCTCGGG - Intronic
1184947600 22:47815029-47815051 GTGCCCAGGGCAGCTCATACTGG - Intergenic
1185051185 22:48555141-48555163 CAGCCCAGGGCCTGGCACACAGG + Intronic
1185222541 22:49636255-49636277 CTCCCCAGGGCGGCCCACCCTGG - Intronic
1185284716 22:49995105-49995127 CTGCCCAGGGCACCCCACACTGG - Exonic
1185331762 22:50255140-50255162 CTGCCCAGAGCCCCCCACTTGGG + Intronic
1203224048 22_KI270731v1_random:67246-67268 GTGACCAGTGCTGCCCACACTGG - Intergenic
1203266779 22_KI270734v1_random:19554-19576 GTGACCAGTGCTGCCCACACTGG + Intergenic
950499174 3:13353118-13353140 CTCCCCAGTGCTGCCCCCACGGG + Intronic
951139707 3:19146921-19146943 CCGCCCCGCGCCGCCCACTCCGG + Intergenic
952568561 3:34685633-34685655 CTGCCCTGCTCCGACCACACTGG + Intergenic
953170832 3:40505890-40505912 CTGCCTGGGGCCGCCCGCTCGGG + Intergenic
960560052 3:119073660-119073682 CTGCCCAGGGCCGGGAGCACCGG + Intronic
961298222 3:125904035-125904057 CTGCCCAGGGCCGGCGGAACTGG - Intergenic
961784742 3:129341114-129341136 CTGCCCAGGGCTGACCCCTCGGG - Intergenic
965092236 3:164179350-164179372 CTGCACAGGGCCGGCGGCACCGG - Intergenic
966736459 3:183190695-183190717 CTGCCCAGGGTCGTCCAGCCAGG - Intronic
967770064 3:193324943-193324965 CTGGCCATGGCCGCACACAGTGG + Exonic
968485377 4:858437-858459 CTGCCCTGGGCAGCCGGCACTGG - Intronic
968514547 4:1010733-1010755 CTGCCCAGGGCCCAGCACGCAGG - Intronic
968567138 4:1318948-1318970 CTGCCCAGGGAAGGCCACACAGG + Intronic
968607751 4:1543495-1543517 CTGGTCAGGGCAGCCCAGACCGG - Intergenic
968760980 4:2442732-2442754 CTCCCCACGGCAGCCCACCCAGG + Intronic
968812779 4:2807638-2807660 CTGCCCTGGGCCCCCGACACTGG - Intronic
968865976 4:3212035-3212057 CTGCACGGTGCCGCTCACACGGG - Exonic
968879945 4:3293431-3293453 CTGCCCGGCGCCGCCCCCGCGGG - Intronic
969135126 4:5023162-5023184 CTGCCTAGGGCCTCCAAAACGGG + Intergenic
969167569 4:5329967-5329989 CTCCCCAGGGCTGCACACCCAGG + Intronic
969288337 4:6222214-6222236 CATCCCAGGGACGCCCTCACTGG - Intergenic
969330382 4:6471138-6471160 GTGCCCAGGGCCCCTCCCACTGG + Intronic
969360321 4:6659031-6659053 CTGCCCAGCGCCTTCCACGCGGG - Intergenic
969377318 4:6771508-6771530 CAGCCCAGGGCCTGGCACACAGG - Intergenic
969638222 4:8381790-8381812 CTGCCCAGGGCCCCCCTGGCTGG + Intronic
973373299 4:49270747-49270769 CTGCCCAGGGGCGGCTGCACCGG - Intergenic
973387706 4:49524461-49524483 CTGCCCAGGGGCGGCTGCACCGG + Intergenic
974839801 4:67286955-67286977 CTGCCCAGGGCCCGCGGCACTGG + Intergenic
974906485 4:68064555-68064577 CTGCCCAAGGCCACACATACTGG + Intronic
979920448 4:126490112-126490134 CTGCCCAGGGCTGGCGGCACCGG - Intergenic
983835406 4:172377794-172377816 CTGCCCAGGGCTGGCTGCACAGG + Intronic
985661256 5:1157848-1157870 CTGCCCACACCTGCCCACACTGG + Intergenic
985719926 5:1483510-1483532 TTGCCCATGGCAGCCCACGCAGG + Intronic
990418954 5:55613454-55613476 CTGCCCGGGGCCGGTCGCACTGG - Intergenic
990888735 5:60624893-60624915 CTGCCCCCGACCCCCCACACAGG + Intronic
991298253 5:65103335-65103357 CTGCCCGGGGCCGCACAAAAGGG - Intergenic
994819333 5:104628409-104628431 GAGCCCAGGGCCGCTCACCCTGG + Intergenic
997401609 5:133607826-133607848 CTGCCCAGGGGCCCCCATCCCGG - Intronic
997626115 5:135331625-135331647 GTTCCCAGGGCCAGCCACACAGG + Intronic
998798393 5:145843089-145843111 CTGCTCATGGCCTCCCCCACTGG - Intergenic
999062882 5:148654372-148654394 CTGCCCGCTGCCGCCCCCACTGG + Intronic
999699984 5:154219208-154219230 CTGGCCAGGGAGGCCCAGACTGG - Intronic
1001033811 5:168282345-168282367 AGGGCCAGGGCCACCCACACTGG + Intergenic
1001470281 5:172006934-172006956 CAGCCCAAGGCTGCCCAGACCGG + Intergenic
1001841533 5:174880771-174880793 CTGCCCGGGGCCGGCGGCACCGG - Intergenic
1002057846 5:176609110-176609132 CTGCCCACTCCCACCCACACTGG - Intronic
1002431840 5:179208459-179208481 CTGCCCAGGGCCGACTGCAGCGG - Intronic
1002431992 5:179209051-179209073 CTGTCCTGGGCCACCCTCACAGG - Intronic
1002445385 5:179287256-179287278 CCGCCCAGGGCTGGCCACATGGG + Intronic
1005401107 6:25435600-25435622 CTGCCCAGGGAAACTCACACTGG - Exonic
1005431800 6:25765044-25765066 CTGCACAGGGCCACCCATGCTGG - Intronic
1006470431 6:34225753-34225775 CTGCCCTGGGCAGCCCTGACCGG + Intergenic
1006636201 6:35462957-35462979 CTGCCCTGGGCCTGCCACAAGGG + Intronic
1007546296 6:42697380-42697402 GGGCCCAGGGACACCCACACAGG - Exonic
1008840297 6:55894793-55894815 CTTCCCAGGGCCGGGCACAGTGG - Intergenic
1008920994 6:56843875-56843897 CTCCCCAGGCCCGCCCACCCTGG + Intronic
1011250059 6:85361843-85361865 CTGCCCAGGGTTGACCACTCAGG + Intergenic
1011410336 6:87060014-87060036 CTGCCCAGGGCTGGCCACAGTGG + Intergenic
1012252668 6:96996096-96996118 CAGCCCAGGGCTGCCCACGCTGG - Intronic
1012462052 6:99474665-99474687 CTGACAAGGGCTGCCCACAATGG + Intronic
1013512964 6:110860226-110860248 CTGCACAGGGACCCCCACCCAGG + Intronic
1016388750 6:143554049-143554071 CTGCCCAGCGCCCCCGCCACTGG - Intronic
1017813204 6:157999191-157999213 CTGGGCAGAGCCGGCCACACTGG - Intronic
1018901450 6:168053837-168053859 CTGCCCCGGGCCTCCCAGATGGG + Intergenic
1019414422 7:920738-920760 CTGCCCAGAGCCACCCACCACGG + Intronic
1019441499 7:1049852-1049874 CTGCCCAGGGCTCCTCGCACGGG - Intronic
1019514929 7:1435372-1435394 GGGCCCTGGGCCGACCACACAGG + Intronic
1019614698 7:1953952-1953974 CTGCCCAGTGCGGCCTCCACTGG + Intronic
1019618363 7:1977373-1977395 CTGCCCGGGGCCGGCAACGCTGG + Intronic
1019697209 7:2452461-2452483 CGGCCCTGGGCCGGCCTCACGGG + Intergenic
1020086996 7:5315903-5315925 CTGCCAGGGGCCGCCCACCCAGG - Intronic
1021250892 7:18323683-18323705 CTGACCAGGGACACCCACCCTGG + Intronic
1021579871 7:22141505-22141527 ATGCCCAGAGCCGGCCCCACAGG + Intronic
1022024075 7:26429455-26429477 CTCCCCAGGGCCTTCCCCACTGG + Intergenic
1022974580 7:35545647-35545669 CTGACCAGGGCCTCTCACAGGGG + Intergenic
1023243821 7:38178731-38178753 CAGCCCGGGGCCGACCCCACCGG - Intronic
1023881385 7:44323479-44323501 CTGGCCAGTGCCACCCACACTGG - Intronic
1024083339 7:45873568-45873590 CTGCCCAGGCCTGCCCAATCAGG - Intergenic
1024231769 7:47368566-47368588 CTCCCCAGGCTCGCCCACCCTGG - Exonic
1024613317 7:51085448-51085470 CTTTCCAGGTCCTCCCACACAGG + Intronic
1025207312 7:57001250-57001272 CTGCCAGGGGCCGCCCACCCAGG + Intergenic
1025664625 7:63575636-63575658 CTGCCAGGGGCCGCCCACCCAGG - Intergenic
1025981945 7:66413978-66414000 CCGCCCAGCGCCGCTCATACTGG + Intronic
1026896781 7:74013964-74013986 CTGACCAGAGCCACCCACCCGGG - Intergenic
1029424237 7:100486519-100486541 CTGCACAAGGCTGTCCACACAGG + Intronic
1029609487 7:101619064-101619086 CGGCCCTGGGCCGTCCACCCTGG + Intronic
1032024628 7:128431296-128431318 CCGCCCTGGGCCACCCACAACGG - Intergenic
1032086292 7:128885523-128885545 CTGCCCAGTGCAGCCCGCACCGG + Intronic
1033214427 7:139483354-139483376 CTGCCCCGAGCCGCCGTCACCGG - Exonic
1034137065 7:148780601-148780623 TAGCCCAGGGCAGGCCACACGGG + Intronic
1034201459 7:149285447-149285469 CTGCCCAGGCCGGCCAGCACAGG + Intronic
1034354919 7:150444292-150444314 CTGCCCAGAGCCGGCTGCACCGG + Intergenic
1034974866 7:155442115-155442137 CTGCCCAGGGCCGCACTCTCTGG + Intergenic
1035321742 7:158034165-158034187 CTGACCAGGGACGCTCACCCAGG - Intronic
1035688180 8:1540711-1540733 CTGGTCACGGCCGCCCACGCTGG - Intronic
1035708614 8:1695894-1695916 CTGGCCAGGGCCGCCCTCCTGGG + Intronic
1037684451 8:21126768-21126790 CTGCCCAGGGCAGCCCAGTAAGG + Intergenic
1040929424 8:52718103-52718125 ATGCCCAGGGCCGGGCACAGTGG - Intronic
1043954047 8:86341717-86341739 GTGCCAAGGACCGCCCACAGTGG + Intergenic
1044569437 8:93700692-93700714 CTGCCCAGGGCCGCCCACACTGG + Intronic
1049225671 8:141449441-141449463 CCGCCCAGGGCTGACCACACAGG - Intergenic
1049367665 8:142248557-142248579 CTGCCCAGAGCCGGCCCCACAGG - Intronic
1049808809 8:144553983-144554005 CTGGCCAGGCCCCCCGACACAGG - Intronic
1051910968 9:22154246-22154268 CTGCCCAGGCCCACTCCCACTGG + Intergenic
1053286366 9:36851904-36851926 TTGCCCAGAGCTGCCCACATTGG + Intronic
1054810683 9:69431458-69431480 CTGCCCAGGGCTGGCCAGAGAGG + Intronic
1057026407 9:91737059-91737081 CTGCCCCGGGCCTGCCACACTGG - Intronic
1057216251 9:93230438-93230460 CAGCTCAGGGCAGGCCACACAGG + Intronic
1057432012 9:95004178-95004200 CCGCCCCGGCCCGCCCTCACCGG + Intronic
1059937101 9:119322316-119322338 CTACCCAGAGCCGCCAACACTGG + Intronic
1060051975 9:120384249-120384271 CTGCCCAGTGCTGCCCTCTCGGG + Intergenic
1060297729 9:122354764-122354786 CTGCTCAGGGCCCACAACACAGG - Intergenic
1060405133 9:123369191-123369213 CTGCCCCAGGGCCCCCACACTGG - Intronic
1060488648 9:124065627-124065649 CTGCCCAGGGTCACCCAGAGGGG - Intergenic
1061215808 9:129221422-129221444 CTGCACAGGGCTGCCCCCAGGGG - Intergenic
1061399714 9:130361751-130361773 CTGCCCAAGGCTGACCACCCAGG - Intronic
1061858828 9:133457483-133457505 CGGCCCAGCCCCGCCCACACAGG + Intronic
1061905457 9:133694436-133694458 TTCCCCAGGGCCGCTCACAGGGG + Intronic
1062158096 9:135065324-135065346 CAGCCCAGGGCAGCCCACCAAGG + Intergenic
1062361730 9:136191519-136191541 CTGCCCAGGGCATCCCACCGTGG + Intergenic
1062363194 9:136197259-136197281 CAGCCCCGAGCCGCCCACCCAGG + Exonic
1062569784 9:137179743-137179765 CTGCCCAGGGCAGCACTCCCAGG - Intronic
1203731898 Un_GL000216v2:98864-98886 CGGCCCTGGGCCGCCCTCCCGGG - Intergenic
1203552201 Un_KI270743v1:172279-172301 CTGCCCAGGGGCGGCTGCACCGG + Intergenic
1185463039 X:341078-341100 CTGCCCCCTGCCGCCCCCACCGG + Intronic
1186522695 X:10220333-10220355 CAGCCCAGGGCCCTCCACTCTGG - Intronic
1190228207 X:48561652-48561674 CTGCCCAGGGCTGCCAGCATTGG - Exonic
1190235325 X:48610687-48610709 ATGCCCAGGGCCGGGCACAGTGG - Intergenic
1190651277 X:52571136-52571158 CTGCCCTGCTCCGACCACACTGG - Intergenic
1194412888 X:93578222-93578244 CTGCCCAGGGCCGCATCCCCAGG + Intergenic
1196412288 X:115433103-115433125 CTGGCCATGGCCAACCACACCGG - Intergenic
1196717268 X:118823847-118823869 CTTCGCAGGGCCGCCCAACCAGG - Exonic
1199875101 X:151922465-151922487 CAGCCCTGGGCACCCCACACAGG + Intronic
1200128927 X:153830696-153830718 CTGCCCATGGCCGCCAGCCCCGG + Intergenic