ID: 1044569439

View in Genome Browser
Species Human (GRCh38)
Location 8:93700695-93700717
Sequence CCCAGGGCCGCCCACACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 251}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044569433_1044569439 -9 Left 1044569433 8:93700681-93700703 CCCGAGCCCAGCTGCCCAGGGCC 0: 1
1: 5
2: 16
3: 75
4: 777
Right 1044569439 8:93700695-93700717 CCCAGGGCCGCCCACACTGGAGG 0: 1
1: 0
2: 1
3: 36
4: 251
1044569429_1044569439 10 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569439 8:93700695-93700717 CCCAGGGCCGCCCACACTGGAGG 0: 1
1: 0
2: 1
3: 36
4: 251
1044569428_1044569439 11 Left 1044569428 8:93700661-93700683 CCCTGGAAAACCGGTAACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1044569439 8:93700695-93700717 CCCAGGGCCGCCCACACTGGAGG 0: 1
1: 0
2: 1
3: 36
4: 251
1044569430_1044569439 1 Left 1044569430 8:93700671-93700693 CCGGTAACAGCCCGAGCCCAGCT 0: 1
1: 0
2: 1
3: 2
4: 121
Right 1044569439 8:93700695-93700717 CCCAGGGCCGCCCACACTGGAGG 0: 1
1: 0
2: 1
3: 36
4: 251
1044569434_1044569439 -10 Left 1044569434 8:93700682-93700704 CCGAGCCCAGCTGCCCAGGGCCG 0: 1
1: 0
2: 7
3: 59
4: 531
Right 1044569439 8:93700695-93700717 CCCAGGGCCGCCCACACTGGAGG 0: 1
1: 0
2: 1
3: 36
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044569439 Original CRISPR CCCAGGGCCGCCCACACTGG AGG Intronic
900116881 1:1032866-1032888 GCCAGGCCCGACCACCCTGGAGG - Intronic
900330898 1:2133940-2133962 CCCAGGGGCGGCCACACTTTCGG - Intronic
900511574 1:3063296-3063318 CCCAAGGCCGCCCACCCCGTGGG - Intergenic
901221465 1:7586182-7586204 GGAGGGGCCGCCCACACTGGAGG - Intronic
901523547 1:9804445-9804467 CCCAGGGAGGCCCTCACAGGTGG - Intronic
901829284 1:11882211-11882233 GGCAGGGCCGCCCTCTCTGGAGG - Intergenic
902873079 1:19325847-19325869 CCCAGGGCCGGACACAGAGGAGG - Intronic
903181129 1:21605485-21605507 CCCAGGGCTGCGCACACAGTAGG + Intronic
904883549 1:33718594-33718616 CCCAGTGCTGACCACACTGCTGG - Intronic
905798355 1:40828132-40828154 CCCAGGGCCACTCTCACTGGGGG - Intronic
905990703 1:42335025-42335047 CCCAGGCCCGGCCGCCCTGGCGG + Intronic
906791380 1:48661246-48661268 GCCAGGGAGGCCCACAGTGGGGG + Intronic
911236933 1:95421953-95421975 CCCAGGCCCGCCAACACCAGAGG - Intergenic
912798443 1:112706717-112706739 CCTGCGGCCGCCCACCCTGGGGG + Intronic
913347287 1:117821090-117821112 CCCAGGGACTCCCACAGTGGTGG - Intergenic
914815524 1:151059544-151059566 GCCCGGGAAGCCCACACTGGCGG - Exonic
915170988 1:153977199-153977221 CCCAGGGCCGCCACCTCTGCTGG - Exonic
917237779 1:172913097-172913119 CCCAGACCCAGCCACACTGGTGG - Intergenic
922717391 1:227884668-227884690 CCCAGGGCACCCCAGACTGGGGG - Intergenic
922754512 1:228088139-228088161 CACAGAGCTGCCCACACTGGTGG + Intronic
923679840 1:236110615-236110637 CCCCAGGCCGCCACCACTGGGGG - Intergenic
923699312 1:236284582-236284604 CCCAGGGCCTCTCACAATGCTGG - Intergenic
1062882290 10:988520-988542 CCCGGGGCCGCCTACCTTGGCGG - Exonic
1065968488 10:30787255-30787277 CCCTGTGCCGCCCATTCTGGGGG + Intergenic
1066541117 10:36447791-36447813 CCCTGGGCCTCCCAAAGTGGTGG - Intergenic
1067732277 10:48820792-48820814 CCCAGGGCCGGCCCCACCTGTGG + Intronic
1067788642 10:49271283-49271305 CCCAGGGCCTGGCACACTGTAGG - Intergenic
1069615213 10:69802455-69802477 CCCAGGGCCGCGGGCACCGGTGG - Exonic
1069814305 10:71183971-71183993 CCCAGGGCAGCCCATGCTGCTGG + Intergenic
1070606057 10:77899201-77899223 TCCAGGCCCTCCCAGACTGGGGG + Intronic
1070831297 10:79419582-79419604 CCAAGGGCCTGGCACACTGGAGG + Intronic
1073064425 10:100749837-100749859 CACAGGGCCGCACACCCTGGTGG - Exonic
1073393648 10:103200282-103200304 CCCAGGGTCTGACACACTGGGGG + Intergenic
1074102777 10:110366499-110366521 CCCAGGGCTGCCAAGGCTGGTGG + Intergenic
1077917157 11:6618889-6618911 CCCAGGGACACCCAGCCTGGGGG + Exonic
1077918596 11:6626626-6626648 CCCAGGGCCGTCCATGCAGGAGG - Exonic
1079238494 11:18706254-18706276 CCCAGCGCCACCAACTCTGGGGG + Intronic
1081583049 11:44365618-44365640 CCCAGGGCCTGGCACACGGGAGG - Intergenic
1082050455 11:47766922-47766944 CCCAGGGCCGCCCCGCCTGCAGG + Intronic
1082803656 11:57432640-57432662 CCCGGGGCAGCCCACCCAGGGGG - Intergenic
1083058628 11:59847044-59847066 CCCAGGCCAGCCCACACTCTAGG - Intergenic
1083649931 11:64196793-64196815 CTCACTACCGCCCACACTGGAGG - Intronic
1083955278 11:65979394-65979416 CCCAGGACTGCCCAGCCTGGTGG + Exonic
1084083398 11:66843513-66843535 CCCAGCGCCGCCGACTCGGGCGG - Exonic
1084216311 11:67648661-67648683 CCCAGAGCCCCCCAGGCTGGTGG - Intronic
1084957950 11:72701562-72701584 GCCAGGGCTGGCCAGACTGGTGG - Intronic
1085182000 11:74543877-74543899 CCCAGGGATGCCCACCCTGCAGG - Intronic
1085450401 11:76628796-76628818 CCCAGGGCCTGACACACAGGTGG - Intergenic
1085701769 11:78752187-78752209 CCCAGGGCCCCGCACAGTGCTGG - Intronic
1088626438 11:111733601-111733623 CCCAGGGCCACCCACATAGTTGG + Intronic
1089374618 11:117985897-117985919 CCCAGGGCCTCCCCGTCTGGGGG - Intergenic
1090135088 11:124189473-124189495 CCCAGGGCCTCCCAAACTGAGGG - Intergenic
1091387570 12:104645-104667 TCCCGGGCCGCCCGCCCTGGTGG + Intronic
1091782592 12:3223325-3223347 CCCAGGGCTGGCCATGCTGGAGG - Intronic
1091841322 12:3623414-3623436 CCCAGGACTGCAGACACTGGGGG + Intronic
1096787743 12:54027319-54027341 TCCAGGGGCGCCTCCACTGGCGG + Intronic
1096789550 12:54036300-54036322 GCCTAGGCCCCCCACACTGGTGG + Intronic
1098915964 12:76257078-76257100 CCCAGGGCTACCCACACTTCTGG - Intergenic
1100436047 12:94572558-94572580 GCCATGGCCTCCCACAGTGGTGG + Intronic
1100992719 12:100267507-100267529 CCCAGGGCCGCTCAGGCTGGTGG + Exonic
1102084480 12:110124641-110124663 CCCAGGGCAGCCCCCGCTAGAGG + Exonic
1103237352 12:119384597-119384619 CTCCGGGCCGCTCCCACTGGTGG + Intronic
1105277526 13:18944446-18944468 CCCAGGGTCTCCCTCACGGGGGG - Intergenic
1105389102 13:19958870-19958892 TCCAGGGCCGCCGAGAGTGGGGG + Intronic
1106911045 13:34463975-34463997 CCCAGGGCCTGACACACTTGAGG + Intergenic
1109215294 13:59583060-59583082 CCCAGGACCACCCCCACTGAGGG + Intergenic
1110915956 13:81021166-81021188 CTAAGGGCAGCCCACACTGAGGG - Intergenic
1112465631 13:99642257-99642279 CCCAGGGTCACCCTCACTAGAGG - Intronic
1113103443 13:106746411-106746433 CCCAGGGCAGCCTCTACTGGTGG - Intergenic
1113544692 13:111139248-111139270 CCCAGGGCGGCACACACTGCAGG + Intronic
1113836727 13:113332911-113332933 TCCTGGGCTGCACACACTGGAGG - Intronic
1118806287 14:69240085-69240107 CCCAGAGACGCCAACACTGCTGG + Intronic
1119691531 14:76676492-76676514 CCCAGGGCCACCAAGACTTGGGG + Intergenic
1119746929 14:77051366-77051388 GCCAGGGCCGCCCACACAGCTGG - Intergenic
1121679644 14:95782639-95782661 TCCAGGGGCTCCCAAACTGGTGG + Intergenic
1121955033 14:98205818-98205840 CCCAGTCCACCCCACACTGGTGG + Intergenic
1122305889 14:100766231-100766253 CCCAGGGTGGCCGACTCTGGTGG - Intergenic
1122378673 14:101286287-101286309 CCCAGGGATGCCCACACAGGAGG - Intergenic
1122695048 14:103548363-103548385 GCCAGGGCCGGGCACACTGGAGG - Intergenic
1123491730 15:20786418-20786440 CCAGGGGCCACCCAGACTGGAGG + Intergenic
1123548232 15:21355512-21355534 CCAGGGGCCACCCAGACTGGAGG + Intergenic
1126953786 15:53911439-53911461 CCCAGGACCCCTCACAGTGGTGG + Intergenic
1128040788 15:64571700-64571722 CCCAGGATCGCCCAGGCTGGAGG + Intronic
1129061870 15:72866954-72866976 CCCAGTGCTGGCCACTCTGGAGG + Intergenic
1129107211 15:73318658-73318680 CCCAGGGCCTACCGCACAGGAGG + Intergenic
1129451267 15:75652516-75652538 ACCAGGGCCTCCCAGGCTGGGGG + Intronic
1129725976 15:77901866-77901888 CCCAGGGACTCCCAGTCTGGGGG + Intergenic
1129888462 15:79055199-79055221 CCCTGGGCCTTCCTCACTGGTGG + Intronic
1131085976 15:89575869-89575891 CCCAGGGCCACCCACACGCACGG + Exonic
1131962978 15:97808532-97808554 CCAAGGGCCACACACAGTGGGGG + Intergenic
1132039208 15:98511183-98511205 CCCAGGGCCGGGCACGCAGGTGG + Intronic
1202956564 15_KI270727v1_random:82742-82764 CCAGGGGCCACCCAGACTGGAGG + Intergenic
1132525762 16:413751-413773 CCCATGGCTGCCCTCACAGGAGG + Intergenic
1132544874 16:528329-528351 CCGGGGGCCGCGCACACCGGAGG + Intronic
1132553000 16:560907-560929 CGCAGGGCGCCCCACACAGGCGG - Intronic
1132558812 16:584319-584341 ACCCGGGCCGCCCACCCTGGGGG + Intergenic
1132956680 16:2598061-2598083 CCCAGTCCCGCCCAGACTAGTGG + Exonic
1132986784 16:2771478-2771500 CACAGGTCCACCCACGCTGGGGG - Exonic
1133131607 16:3679643-3679665 CCCAGGGCCACCCCTACTGGAGG + Intronic
1133632629 16:7636057-7636079 GCCTTGGCCGCCCACAGTGGTGG + Intronic
1134717622 16:16364724-16364746 CTCAGGGCCCCCGACACGGGCGG - Intergenic
1134957130 16:18387435-18387457 CTCAGGGCCCCCGACACGGGCGG + Intergenic
1135259672 16:20970024-20970046 CCCAGGGCCTGGCACAATGGGGG + Intronic
1135818183 16:25655292-25655314 CCCAGGGCTGCCCTGACTAGTGG - Intergenic
1136414707 16:30096122-30096144 CCCAGGCCAGCCCACCCCGGCGG - Exonic
1136418119 16:30115732-30115754 CCCAAGGCTGCCCAGACTGGTGG - Intronic
1137250560 16:46737726-46737748 GCCAGGGCAACCCACAGTGGTGG - Exonic
1137379525 16:47984353-47984375 CCCAAGGCCACCCACCCAGGAGG - Intergenic
1137580796 16:49632402-49632424 CCCAGGTGTGCCCACACAGGGGG + Intronic
1137930284 16:52580697-52580719 CCCAAGGTCACCCACACTGCTGG + Intergenic
1139023284 16:62780185-62780207 CCCATGGCCTGCCCCACTGGCGG + Intergenic
1139207504 16:65043542-65043564 TCCAGGGCAGCTCACATTGGAGG - Intronic
1139966372 16:70747739-70747761 CTCTGGGCGGCCAACACTGGTGG + Intronic
1140111481 16:72008883-72008905 CCCAGGGGGGCCCACACTCCCGG - Intronic
1140232144 16:73126164-73126186 CCCAGAGCCTCCCAGAATGGAGG - Intergenic
1141426393 16:83947194-83947216 TCCACGGCCACCCACACTGTAGG - Intronic
1141576577 16:84967789-84967811 CCCAGGGCCGCTCATATTGGTGG - Intergenic
1141593309 16:85082725-85082747 CCCAGGGCCGCCCTCCCCGCCGG - Intronic
1141981082 16:87550873-87550895 CCCAGGGCTGCAGACGCTGGGGG - Intergenic
1142214455 16:88823836-88823858 CCCAGGACGGCCCTCACAGGCGG + Intronic
1142227506 16:88884817-88884839 CCCGAGGCCGCCCACCCCGGGGG + Intronic
1142298386 16:89241813-89241835 ACCAGAGCCTCCCACACTGCTGG + Intergenic
1142642968 17:1295352-1295374 CCCATGGCAGCCCACACTCTAGG - Intronic
1142758780 17:2030938-2030960 CCCACCGCCGCCCACACAGTGGG + Intronic
1144781532 17:17810678-17810700 CCCAGTCCCGCCCACACTCGGGG - Exonic
1144850432 17:18241381-18241403 CCCAGGGCCCCTCACCCTCGTGG - Intronic
1145320595 17:21765025-21765047 CGCTGGGTCGCCCAGACTGGAGG + Intergenic
1146828682 17:36047538-36047560 CCTAGGGATGCCCACACTGAGGG - Intergenic
1147875386 17:43617143-43617165 CCCAGAGGTGCACACACTGGGGG - Intergenic
1147899154 17:43772564-43772586 CCCTGGGCCCCACACACTGTTGG + Intronic
1148198026 17:45728802-45728824 CCCAGGGGCGCCTGCACTTGTGG + Intergenic
1149384650 17:56130044-56130066 CCCAGGGCCGCTCAGACAGTTGG + Intronic
1152066975 17:78117438-78117460 CCCAGGGCCGCCCCCACCTGCGG + Intronic
1152148174 17:78581765-78581787 ACCTGGGCCTCCCACACTGCTGG - Intergenic
1152278326 17:79371093-79371115 CCCAGGGACACCCAGACAGGAGG - Intronic
1152306196 17:79522043-79522065 ACCAGTGCAGGCCACACTGGAGG + Intergenic
1152489799 17:80622649-80622671 CCCAGGGCCTCCCAAAGTGCTGG - Intronic
1152594605 17:81232209-81232231 CCCAGGGCCTCCCACACAGCAGG - Intronic
1152614237 17:81330572-81330594 CCCACGGCAGCCCCCACTGTTGG - Exonic
1152734592 17:81991252-81991274 CCAGGGGCCGGGCACACTGGGGG - Intronic
1158865686 18:61635946-61635968 CCCAGGGCTGCCCACACACCTGG - Intergenic
1160572461 18:79827445-79827467 CCCAGGCCCTGCCCCACTGGTGG - Intergenic
1160871124 19:1278495-1278517 CCCAGTGCCTCCCTCCCTGGGGG - Intronic
1160943201 19:1629591-1629613 CCCCAGGCCCTCCACACTGGGGG - Intronic
1161666146 19:5578272-5578294 TCCAGGGCCTCCCACAAAGGTGG + Intergenic
1161748066 19:6074014-6074036 CCCAGGGCCGGCCTGTCTGGGGG - Intronic
1162088370 19:8262032-8262054 CCCAGGCCAGCCCCCACTGATGG + Exonic
1162140979 19:8585466-8585488 TCGAGGGCCGCCCACTCCGGAGG + Exonic
1163846951 19:19643359-19643381 CACAGGGCTCCCCACAATGGAGG + Intronic
1163962017 19:20705394-20705416 CCCTGTGTCGCCCACCCTGGAGG - Intronic
1164615972 19:29666925-29666947 CCCAGGGGCGGCCCCTCTGGAGG + Intronic
1165100486 19:33435886-33435908 CCCAGGGCTGTAAACACTGGTGG + Intronic
1165342553 19:35223425-35223447 CACAGGTCTGTCCACACTGGAGG + Intergenic
1165427081 19:35752269-35752291 CACAGGGCCGGGCACCCTGGTGG + Intronic
1165821510 19:38679318-38679340 CACAGTGCCGGGCACACTGGAGG - Intronic
1166700286 19:44878255-44878277 CCCACGGCCCCCCACACCAGCGG - Intronic
1167211621 19:48137218-48137240 CCCATGGCCGCCCACTCTTAGGG + Intronic
1167284449 19:48591196-48591218 CCCAGAGCCCCACACACAGGAGG - Intronic
1167593590 19:50416716-50416738 GCCAGGGCCGCTCACCCTGGTGG - Exonic
1167650427 19:50725586-50725608 CCCAGAAGCGCCCAGACTGGGGG - Exonic
925121513 2:1422008-1422030 CCCAGGGAGCCCCACACCGGGGG + Intronic
926622206 2:15057077-15057099 CCCTGGGCCTCCCAAAGTGGTGG + Intergenic
927518578 2:23686166-23686188 CCCAGTGCAGCCCCCTCTGGAGG - Intronic
928362672 2:30678473-30678495 CACAGGGCCTCCCCCACTGTGGG - Intergenic
929000628 2:37344526-37344548 CCCAGGGCCGCCCAGCCCCGGGG + Intergenic
929587951 2:43127818-43127840 CCCAGTGCTGTCCACACCGGCGG - Intergenic
929857038 2:45646220-45646242 CCCAGGGCCTCCCAAAATGCTGG + Intergenic
932500747 2:72180707-72180729 CAAAGGGCCACCCACAGTGGGGG - Intronic
932689663 2:73901409-73901431 GCGAGGGCGGCCCACAATGGAGG - Exonic
932842614 2:75097671-75097693 CCCAGGGTCACCCAAACTTGAGG + Intronic
934518436 2:95004318-95004340 CTCCGGGCTGTCCACACTGGGGG - Intergenic
934973842 2:98786481-98786503 GCCTGGGCAGCCCGCACTGGCGG + Intergenic
934993554 2:98937293-98937315 GCTAGCGCCGCGCACACTGGAGG + Intergenic
937280692 2:120715504-120715526 CCCTGAGCTGCCCACACTGATGG + Intergenic
937400353 2:121577542-121577564 CCCAGAGATGCCCACACTGTGGG - Intronic
937937736 2:127259546-127259568 CCCAGGCCCAGCCACCCTGGTGG + Intronic
944259666 2:197662873-197662895 CCCATGGCCTCCCAAACTGCTGG + Intronic
944887051 2:204073642-204073664 GCCAGGGCCTCCAACAATGGAGG + Intergenic
945545453 2:211144872-211144894 CCCAGACCCAGCCACACTGGGGG + Intergenic
947637147 2:231685945-231685967 CACAGGGCCCACCTCACTGGGGG + Intergenic
948423646 2:237875206-237875228 CCCAAGGCTGCCCTGACTGGGGG + Intronic
948467633 2:238159828-238159850 CCAAGGCCCGGCCACACTGAGGG - Intronic
1171334386 20:24370511-24370533 CCCTGGGCCTCCCACAATGGAGG + Intergenic
1172096466 20:32463013-32463035 CCCAAGGTCGCCCAGACTGCAGG - Intronic
1172113280 20:32559916-32559938 CCCAGGGCAGGCCACACTGCTGG - Intronic
1172624333 20:36338629-36338651 CCCAGGGCCTTGCACACAGGCGG - Intronic
1173903418 20:46607614-46607636 CCCAAGGCCACACACAGTGGTGG - Intronic
1175733507 20:61370169-61370191 CCCAGGGCCACCCACCCTCGGGG - Intronic
1175913383 20:62414938-62414960 CCCAGGCCTGGCCACTCTGGAGG + Intronic
1175998330 20:62821195-62821217 CCCGGGGCCGCCCGGGCTGGGGG + Exonic
1178351765 21:31876702-31876724 CCCTGGGTCACCCACAGTGGGGG - Intronic
1179541545 21:42086135-42086157 CCCAAGGCCGCCCTCCCTGGGGG + Intronic
1179982211 21:44901435-44901457 GACAGAGCCCCCCACACTGGGGG + Intronic
1181010201 22:20035744-20035766 GGCAGGGCTGCCCCCACTGGTGG + Intronic
1181053583 22:20248964-20248986 CCCAGTGAGCCCCACACTGGGGG + Intronic
1181422992 22:22814691-22814713 CCCAGGGCTACCGACACTGAGGG - Intronic
1181559656 22:23692725-23692747 CCCAGGTCCGCCAGCAGTGGTGG - Exonic
1183269779 22:36853849-36853871 CCCAGGTCTGCACAGACTGGGGG - Intergenic
1183674330 22:39291259-39291281 CCCAAGGCCCCAGACACTGGAGG + Intergenic
1183716239 22:39535168-39535190 CCCTGGGCAGCCCAGCCTGGTGG - Intergenic
1183940326 22:41290972-41290994 CCCAGGGTCCCCTCCACTGGTGG + Intergenic
1183976498 22:41515435-41515457 CCCAAGGCCGCCACCATTGGGGG - Exonic
1184509602 22:44925915-44925937 CCCAGGCCAGCCCAGACTGTGGG + Intronic
949959953 3:9303875-9303897 CCCAGGGCCCAGCACACTGTAGG - Intronic
952568563 3:34685636-34685658 CCCTGCTCCGACCACACTGGAGG + Intergenic
959693939 3:109229812-109229834 CCTAGGGCCCCCCATACTGTAGG - Intergenic
960534586 3:118802414-118802436 CCAGGGGCCCCCCACAGTGGTGG - Intergenic
961802257 3:129460507-129460529 CCCTTGGCCGCCCAAACTGCTGG + Intronic
966771442 3:183507681-183507703 CCCTGGGCCTCCCAAACTGCTGG + Intronic
968933355 4:3596204-3596226 CCCAGGGCAGCGCCCACTGATGG + Intergenic
969634145 4:8356305-8356327 CCCACTGCCTCCCACACTGCTGG + Intergenic
969638224 4:8381793-8381815 CCCAGGGCCCCCCTGGCTGGAGG + Intronic
971126853 4:23763841-23763863 CCCTTGCCCGCCTACACTGGTGG + Intronic
972279693 4:37590295-37590317 CCAAGGGCCGCTCCCACAGGGGG + Exonic
975160395 4:71118124-71118146 CCTAGGGCCTCCCACAGTGCTGG + Intergenic
979364262 4:119801870-119801892 CCCTGGGCCTCCCACAGTGTTGG + Intergenic
981732358 4:147912895-147912917 CCCTGGGCCTCCCAAAGTGGTGG + Intronic
982380073 4:154740629-154740651 CCCGGGGCCGACCACCCTGCGGG + Intronic
983020490 4:162670144-162670166 CCCAAGGCCGCCCACACAAGGGG + Intergenic
983656820 4:170091656-170091678 CCCAGTGCCGGCTCCACTGGGGG + Intronic
984889028 4:184474868-184474890 CCCAGGGGCGCCCGCACGTGCGG + Intergenic
985540744 5:486291-486313 CCCAGGGCTGGCCTCACTGACGG + Intronic
985733899 5:1566258-1566280 CCAGGGGCGGCCCACACTGTGGG + Intergenic
985988284 5:3535612-3535634 GCCGGGGACGCCCAGACTGGAGG + Intergenic
992008560 5:72504199-72504221 CCCAGGGCTGAGCACACTTGGGG - Intronic
998367442 5:141640232-141640254 CCCAGGGCTGCCCACTCAAGAGG + Exonic
1001148972 5:169210147-169210169 CCCAGGGCAGTCCACAGTGAGGG + Intronic
1001576966 5:172770967-172770989 CGCAGGGCCGATCACGCTGGGGG - Exonic
1002103333 5:176868125-176868147 CCCAGGGCTGCCCACCATGGAGG + Exonic
1003060801 6:2860564-2860586 CCCAGTGGACCCCACACTGGGGG - Intergenic
1003537815 6:6991106-6991128 GCCTGGGCCTCCCACACTGCTGG - Intergenic
1005994718 6:30924262-30924284 CCCATGGCCTGCCCCACTGGCGG + Intronic
1006340004 6:33441670-33441692 GCCGGGGCCGCTCACTCTGGCGG - Exonic
1006342173 6:33452840-33452862 CACAGGTCCCCCCACCCTGGGGG - Exonic
1006505432 6:34485977-34485999 CCCAGTGCCGCCCACGTTGCGGG - Intronic
1006741987 6:36315524-36315546 CCCAGGGTCACCCAGCCTGGGGG + Intergenic
1007546294 6:42697377-42697399 CCCAGGGACACCCACACAGGTGG - Exonic
1008047382 6:46864916-46864938 CCCAGGGCCTACCACAGTGAGGG + Intronic
1008920997 6:56843878-56843900 CCCAGGCCCGCCCACCCTGGTGG + Intronic
1010011387 6:71051626-71051648 CCCAGGGCTCCCCACAGTGAGGG + Intergenic
1011916377 6:92511444-92511466 CCCAAGACTGCACACACTGGGGG - Intergenic
1013412294 6:109892942-109892964 CCCAGGTGCGGCCAGACTGGAGG + Intergenic
1016753031 6:147651913-147651935 CCCAGGCCCGCACAGAGTGGGGG + Intronic
1018723502 6:166591910-166591932 CCCAAGCCGGCCCACACTGATGG + Intronic
1022502645 7:30892316-30892338 CCCAGGGCCAACCACATTGGAGG - Exonic
1023875139 7:44282731-44282753 CACAGGCCCGCCCCCACAGGTGG + Intronic
1024540606 7:50472650-50472672 CCCAGGACCGTGCAAACTGGAGG + Intronic
1028557226 7:92137064-92137086 ACCAGGGCCTCCCAAAGTGGTGG - Intronic
1028622309 7:92837085-92837107 CCCAGGGTCGCCCAGAGTTGGGG + Intergenic
1029080718 7:97972071-97972093 CACAGGGCCGCCGCCCCTGGGGG + Intergenic
1029548762 7:101225259-101225281 CCCAGGGCCACCCAGACCAGGGG - Intergenic
1030934106 7:115563101-115563123 CCCAGTGCCTCGCACACTGTAGG - Intergenic
1033127763 7:138720131-138720153 CCCAGGGCCACCCTCACTTCAGG - Intronic
1033663763 7:143422364-143422386 CCCAGGTCCCCCCAGCCTGGGGG - Intergenic
1035308181 7:157946848-157946870 GCCCCGGCCGTCCACACTGGTGG - Intronic
1035547054 8:489718-489740 TGCAGGGCCCCCCACTCTGGAGG - Intergenic
1037143116 8:15540700-15540722 CCCAGGGCCTCCCACCCTCGCGG - Intronic
1037482142 8:19314379-19314401 CCCAGGGGCGCCCCCACGTGGGG + Intronic
1038209911 8:25507224-25507246 TACAGAGCTGCCCACACTGGAGG - Exonic
1040391156 8:46951630-46951652 CCAAGGGCTGCCCACATTAGAGG - Intergenic
1042835083 8:73072417-73072439 ACCATGGCCTCCCACACTGCTGG - Intronic
1044569439 8:93700695-93700717 CCCAGGGCCGCCCACACTGGAGG + Intronic
1045387984 8:101689654-101689676 CCCAGGGCCGGGCACACAGTGGG - Intronic
1046497758 8:115036791-115036813 CCCAGGGCCGCTCCCAGTGTGGG - Intergenic
1049018403 8:139937608-139937630 ACCAGCGTCGTCCACACTGGAGG + Intronic
1049612271 8:143561175-143561197 CCCACGGCAGCCCAAGCTGGCGG - Intronic
1051310217 9:15762982-15763004 CCCAGGGCCACCCTCACTTCAGG + Intronic
1053286368 9:36851907-36851929 CCCAGAGCTGCCCACATTGGAGG + Intronic
1053316359 9:37055188-37055210 CCCAGGGCTGCCTGCACTGGGGG + Intergenic
1053321351 9:37101556-37101578 CCCAGGGCTGCCTGCACTGGGGG + Intergenic
1057216252 9:93230441-93230463 CTCAGGGCAGGCCACACAGGTGG + Intronic
1060811820 9:126614557-126614579 CCCCGGGCCCGCCACTCTGGGGG + Exonic
1060937984 9:127527023-127527045 CCCAGGGCAGCCCAGTTTGGGGG + Intronic
1061144055 9:128787045-128787067 CCCAGCGCCGCCGACCCTGCGGG - Intergenic
1061630273 9:131867876-131867898 CCCAGGGGTGCCCACACTGCTGG + Intronic
1061674895 9:132210089-132210111 CCCAGGGTGGCCCACCCTGGTGG + Intronic
1062255421 9:135618598-135618620 CTCAGGGCCACCCACCCTGGCGG - Intergenic
1062320361 9:135987912-135987934 CCCAGGGGGACCCATACTGGAGG - Intergenic
1062322933 9:135999142-135999164 CCCAGAGCTGCCCACAGTGGAGG - Intergenic
1062393305 9:136342588-136342610 CCCAGGGCCGCCCAGGCTCTAGG - Intronic
1062548996 9:137077429-137077451 CCCGGGGCCCGCCCCACTGGGGG + Intergenic
1185452815 X:291796-291818 GCCAGGGCCCCCCACACTGCGGG - Intronic
1185619177 X:1442893-1442915 GCCAGGGGCTCCCCCACTGGAGG - Intronic
1187052750 X:15710962-15710984 ACCAGGGCTTCCCACACTTGAGG - Intronic
1187825648 X:23332526-23332548 CCCAGGGACGGCGATACTGGGGG + Intergenic
1189740602 X:44113751-44113773 AACAGGGACACCCACACTGGTGG + Intergenic
1190651275 X:52571133-52571155 CCCTGCTCCGACCACACTGGAGG - Intergenic
1199607320 X:149586886-149586908 GCCAGTGACTCCCACACTGGGGG - Intronic
1199631803 X:149782481-149782503 GCCAGTGACTCCCACACTGGGGG + Intronic