ID: 1044569443

View in Genome Browser
Species Human (GRCh38)
Location 8:93700701-93700723
Sequence GCCGCCCACACTGGAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044569430_1044569443 7 Left 1044569430 8:93700671-93700693 CCGGTAACAGCCCGAGCCCAGCT 0: 1
1: 0
2: 1
3: 2
4: 121
Right 1044569443 8:93700701-93700723 GCCGCCCACACTGGAGGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 221
1044569428_1044569443 17 Left 1044569428 8:93700661-93700683 CCCTGGAAAACCGGTAACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1044569443 8:93700701-93700723 GCCGCCCACACTGGAGGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 221
1044569436_1044569443 -10 Left 1044569436 8:93700688-93700710 CCAGCTGCCCAGGGCCGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 426
Right 1044569443 8:93700701-93700723 GCCGCCCACACTGGAGGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 221
1044569433_1044569443 -3 Left 1044569433 8:93700681-93700703 CCCGAGCCCAGCTGCCCAGGGCC 0: 1
1: 5
2: 16
3: 75
4: 777
Right 1044569443 8:93700701-93700723 GCCGCCCACACTGGAGGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 221
1044569429_1044569443 16 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569443 8:93700701-93700723 GCCGCCCACACTGGAGGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 221
1044569434_1044569443 -4 Left 1044569434 8:93700682-93700704 CCGAGCCCAGCTGCCCAGGGCCG 0: 1
1: 0
2: 7
3: 59
4: 531
Right 1044569443 8:93700701-93700723 GCCGCCCACACTGGAGGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 221
1044569435_1044569443 -9 Left 1044569435 8:93700687-93700709 CCCAGCTGCCCAGGGCCGCCCAC 0: 1
1: 0
2: 0
3: 42
4: 376
Right 1044569443 8:93700701-93700723 GCCGCCCACACTGGAGGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044569443 Original CRISPR GCCGCCCACACTGGAGGGCT GGG Intronic
900682506 1:3924653-3924675 CCCGCCCACACTGGCAGGCAAGG - Intergenic
901103014 1:6733945-6733967 GTCACCCAGACTGGAGTGCTGGG + Intergenic
901648028 1:10727111-10727133 GCCACCCTCCCTGGTGGGCTGGG - Intronic
902163632 1:14552339-14552361 GCGGCCCAGGCAGGAGGGCTGGG + Intergenic
903936804 1:26901203-26901225 GTCGCCCAGGCTGGAGTGCTGGG + Intronic
904889268 1:33766163-33766185 CGCGCCCACACTGCAGGACTGGG - Intronic
905393133 1:37650870-37650892 GATGCCCATACTGGAGGGCCAGG + Intergenic
907226028 1:52947020-52947042 GTCGCCCAGGCTGGAGGGCAAGG - Intronic
908431977 1:64067404-64067426 GTCGCCCAGGCTGGAGTGCTGGG - Intronic
908829246 1:68163347-68163369 GGCGCCCACTCTGGAGGCCGCGG + Intronic
911215513 1:95188448-95188470 ACAGCCCACACTTGAGGACTAGG + Intronic
912350895 1:109011980-109012002 GCTGCCCACGCTGGAGTGCAGGG + Intronic
913328622 1:117649508-117649530 TCAGCCCACACTGGAGGGAAAGG + Intergenic
915407331 1:155670712-155670734 GTCGCCCAGACTGGAGTGCGTGG + Intronic
922288989 1:224194820-224194842 GTCGCCCAGACTGGAGTGCAGGG - Intergenic
924124333 1:240834547-240834569 ACCGCCCAGACTGGAGTGCAGGG + Intronic
1064129362 10:12695330-12695352 GCAGCCCATATTGGAGGGGTGGG - Intronic
1066339214 10:34513316-34513338 GCCGCCCAGGCTGGAGTGCAAGG + Intronic
1068559935 10:58502997-58503019 ACAGCCCACACTGGAGGGGAAGG - Intergenic
1069552918 10:69376871-69376893 GCGCCCCACACACGAGGGCTGGG - Intronic
1069813569 10:71179679-71179701 GCTGCCCCCACAGCAGGGCTGGG - Intergenic
1070574404 10:77666663-77666685 GTGGCCCACACTGGGGGGCCTGG + Intergenic
1071285383 10:84139645-84139667 GCCGCCCTCACGGGACCGCTGGG + Intronic
1072686550 10:97540875-97540897 GCCGCCCACACAGCCTGGCTGGG - Intronic
1074134501 10:110615036-110615058 GGCCCCCAAGCTGGAGGGCTGGG + Intergenic
1074422613 10:113322699-113322721 GCCGACCACCCTGGGGGCCTCGG + Intergenic
1074815914 10:117140566-117140588 GCCCCCTACCCTGGAGGGGTTGG + Intergenic
1074961094 10:118446826-118446848 GTTGCCCACACTGGAGTGCAGGG - Intergenic
1076648266 10:131969531-131969553 GCCACGCACACGGGAGGGCGAGG + Intronic
1077232898 11:1466218-1466240 GTCACCCAAACTGGAGTGCTGGG - Intergenic
1077237657 11:1489553-1489575 GCAGACCACACTGAAGGGGTGGG + Intronic
1078301648 11:10136522-10136544 GCCTCCAAAACTGCAGGGCTTGG + Intronic
1080537771 11:33238845-33238867 GTCACCCACACTGGAGTGCAGGG - Intergenic
1082083362 11:48029069-48029091 GCACCCCACACTGCAGGCCTAGG - Intronic
1083244034 11:61411786-61411808 GGCACCCACACTGTAGGACTTGG + Exonic
1083610022 11:64000133-64000155 GCGGCCCCCACAGGAGTGCTGGG - Intronic
1083786127 11:64948693-64948715 GCCGCCCAGGCTGGAGTGCAGGG + Intronic
1084297424 11:68222001-68222023 GCCCCCCACACTGGGGGGGACGG - Intergenic
1085043235 11:73339010-73339032 GCTGCCCAAACTGGAAGACTAGG - Intronic
1088971263 11:114776345-114776367 GCCTCCCACTCTGGAGAGCTCGG - Intergenic
1090847852 11:130545926-130545948 CCCGCCCAGACTACAGGGCTTGG - Intergenic
1093020036 12:14194859-14194881 GCCCACCACACTTGAGAGCTCGG + Intergenic
1093736412 12:22625313-22625335 GGCGCCCTCGCGGGAGGGCTGGG - Exonic
1099588890 12:84559492-84559514 GTCGCCCAGGCTGGAGTGCTCGG - Intergenic
1102368347 12:112359456-112359478 GTCGCCCACACTGGAGTGCAGGG + Intronic
1104080910 12:125429915-125429937 GCAGCCCACGCTGAAGGGGTGGG + Intronic
1104594963 12:130114679-130114701 GCCGCCCAAGCTGGAGTGCAAGG - Intergenic
1105417503 13:20226026-20226048 GCAGCCCACATTGGAAGGGTGGG + Intronic
1106340242 13:28820239-28820261 GCCGCCCCCGCTCGAGGGCCGGG - Intergenic
1106834867 13:33623057-33623079 GCTGCCTACACTGGAGTGCATGG - Intergenic
1111216385 13:85147947-85147969 GTAGCCCACACTGAAGGGGTGGG - Intergenic
1113307111 13:109090576-109090598 CACGCCCACACTGCAGGGCAGGG - Intronic
1114250579 14:20956835-20956857 GTCGCCCAGACTGGAGTGCGTGG + Intergenic
1119431028 14:74568021-74568043 GCCACCCAGACTGGGGGGCAGGG + Intronic
1119764910 14:77182114-77182136 GCCGCCCACCCGGGAGGGCGTGG + Intronic
1121677427 14:95765344-95765366 GCAGCCCAAACAGGAGGGGTTGG + Intergenic
1122121128 14:99554047-99554069 GCCGACCACACTGGGTGGCGGGG - Intronic
1122279695 14:100614212-100614234 GCCACCCACACTTGAGGGGTGGG + Intergenic
1122631902 14:103111166-103111188 GGGGCCCACTGTGGAGGGCTGGG - Intergenic
1122695046 14:103548357-103548379 GCCGGGCACACTGGAGGCCCTGG - Intergenic
1122997973 14:105275924-105275946 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122997997 14:105276030-105276052 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998022 14:105276136-105276158 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998034 14:105276189-105276211 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998060 14:105276295-105276317 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998072 14:105276348-105276370 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998097 14:105276454-105276476 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998123 14:105276560-105276582 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998148 14:105276666-105276688 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998160 14:105276719-105276741 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998171 14:105276772-105276794 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998183 14:105276825-105276847 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998195 14:105276878-105276900 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998236 14:105277037-105277059 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998248 14:105277090-105277112 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998302 14:105277302-105277324 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998327 14:105277408-105277430 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998351 14:105277514-105277536 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1122998362 14:105277567-105277589 GCGGCCCTCACTAGAGAGCTGGG + Intronic
1128191094 15:65698228-65698250 GTCGCCCAGACTGGAGTGCAGGG - Intronic
1131179942 15:90232889-90232911 GTCGCCCAGGCTGGAGTGCTGGG - Intronic
1132736751 16:1389852-1389874 GTCGCCCAGGCTGGAGTGCTTGG + Intronic
1134060334 16:11195750-11195772 GTCACCCAGACTGGAGTGCTGGG + Intergenic
1135412793 16:22247859-22247881 GCCGCACACAGTGGAGGGTAAGG - Intronic
1135420487 16:22302682-22302704 GCAGCCCACACTTGTTGGCTTGG + Intronic
1135489170 16:22893824-22893846 GTCGCCCAGACTGGAGTGCAGGG + Intronic
1135732336 16:24905401-24905423 GTCGCCCAGACTGGAGTGCGTGG - Intronic
1137459556 16:48648201-48648223 ACCACCCACACTGGAGTGCAGGG + Intergenic
1137646203 16:50076905-50076927 GCCGCCCAGGCTGGAGTGCGTGG + Intronic
1139371086 16:66469873-66469895 GCCGCCCACCCTGGGGCCCTGGG + Exonic
1140035345 16:71367522-71367544 GCCATCCACAATCGAGGGCTGGG + Intronic
1141356373 16:83350273-83350295 GCCCCCCACCCTGGACGGGTGGG + Intronic
1141851737 16:86650766-86650788 GCTGCCCAGGCTGGAGTGCTGGG + Intergenic
1141949810 16:87333245-87333267 GCCGCTGCCACTGCAGGGCTTGG - Intronic
1141968374 16:87462699-87462721 GTCGCCCAGGCTGGAGTGCTGGG - Intronic
1142030295 16:87835209-87835231 GCAGCCCACACTGATGGGCTGGG - Intronic
1142621199 17:1166656-1166678 GCTGCCCACACTGGATGGGAAGG - Intronic
1142742577 17:1939831-1939853 GGCCCCCACCCTGGAGGGCCAGG + Intronic
1143250443 17:5519482-5519504 GTAGCCCACACTGGAGTGCAGGG + Intronic
1147569382 17:41559072-41559094 GTCGCCCAGACTGGAGTGCAGGG + Intergenic
1149635877 17:58168819-58168841 GCCGCCCACAGTGGAGGGCAGGG + Intergenic
1150291649 17:63985749-63985771 GCCACCCTCCCTGGATGGCTGGG - Intergenic
1150716353 17:67575679-67575701 TCAGCATACACTGGAGGGCTTGG + Intronic
1151175540 17:72284917-72284939 GCTGTCCACACTGGAAGGCAGGG + Intergenic
1152537463 17:80959135-80959157 GCTGCCCACACGGGAAGGCCTGG - Intronic
1153198413 18:2625458-2625480 GCCGCCCACAGTGATGGGCAAGG + Intergenic
1153712769 18:7817011-7817033 GGCGCCCAGGCTGGAGGGCAGGG + Intronic
1154197292 18:12276030-12276052 GCTGCCCAGGCTGGAGGGCAGGG + Intronic
1155828464 18:30480689-30480711 GCCGCCCAGGCTGGAGTGCAGGG + Intergenic
1156367619 18:36444152-36444174 GTCGCCCATGCTGGAGGGCAGGG - Intronic
1158322218 18:56275900-56275922 GTCACCCACACTGGAGTGCAGGG - Intergenic
1158682439 18:59580870-59580892 GCTGGCCACACTGGGGGGCCTGG + Intronic
1159045842 18:63367588-63367610 CACGCCCACACTGGAGGCCGTGG - Intergenic
1160189796 18:76706552-76706574 GGAGCCCCCACTGGAGGGCGGGG - Intergenic
1160501261 18:79402018-79402040 ACAGCCCACCCTGGAGGCCTGGG - Intronic
1160568415 18:79800574-79800596 GCCTCCCACACGGGAAGGCGGGG - Intergenic
1160820409 19:1055172-1055194 GCCGGCTACACTGGCAGGCTGGG - Exonic
1161147392 19:2687094-2687116 GTCACCCACACTGGAGTGCAGGG + Intronic
1161875484 19:6905389-6905411 GTCGCCCAGACTGGAGTGCAGGG + Intronic
1161971679 19:7584998-7585020 GCTGCCCACACTGGAGAGGAGGG + Intergenic
1162805027 19:13133315-13133337 GTCGCCCAGGCTGGAGTGCTGGG - Intronic
1163373491 19:16915460-16915482 TCAGCTCACACTGCAGGGCTGGG - Intronic
1163532567 19:17859233-17859255 GCCGCCCACTTTGAGGGGCTTGG - Intergenic
1163607149 19:18281596-18281618 GCCGCCGCCAGTGGAGGGCCGGG - Exonic
1164679707 19:30125769-30125791 GCAGCCCACACTTAAGAGCTGGG - Intergenic
1165851295 19:38851723-38851745 GTCGCCCACGCTGGAGTGCAGGG - Intronic
1166278553 19:41773838-41773860 ACCGCCCACGCTGGATGGCCAGG + Intergenic
928150807 2:28826988-28827010 GTCGCCCAAGCTGGAGTGCTCGG + Intronic
932490299 2:72115909-72115931 CCCACCCTCACTGGAGGGCCGGG - Intergenic
934126099 2:88892427-88892449 GCAGCCTCCACTTGAGGGCTTGG + Intergenic
935145117 2:100390335-100390357 GGCGCCCAGACAGGAAGGCTGGG - Intergenic
937041108 2:118821408-118821430 GCCACCCACTCTGGTGGGCAGGG - Intergenic
937289429 2:120773350-120773372 CCCCCTCACACTGCAGGGCTTGG - Intronic
937982311 2:127622926-127622948 GCTGCCCCCACTGGAGGTCCAGG + Intronic
939956633 2:148532867-148532889 GCTGCCCACACAGGGGAGCTTGG + Intergenic
942124353 2:172808912-172808934 GCCGCCCATGCTGGAAGGCAGGG - Intronic
948378510 2:237537821-237537843 TCCACTGACACTGGAGGGCTGGG - Intronic
949069041 2:242012453-242012475 GTCGCCCAGGCTGGAGGGCAGGG + Intergenic
1168982063 20:2013229-2013251 GTTGCCCAAACTGGAGGGCAGGG - Intergenic
1170661362 20:18343556-18343578 GCCGCCCAGGCTGGAGTGCAGGG - Intergenic
1170874114 20:20234753-20234775 GCCGCCTTCCCTGGAGGGCTGGG - Intronic
1171225316 20:23437771-23437793 GTCGCCCAGGCTGGAGTGCTTGG + Intergenic
1172252832 20:33491738-33491760 GTCGCCCAGACTGGAGTGCAGGG + Intronic
1175416421 20:58804320-58804342 ACTGCCCACACTGGAGGGAGTGG - Intergenic
1175871071 20:62209732-62209754 GCCCCTCACTCTGGTGGGCTCGG - Intergenic
1176005368 20:62859757-62859779 GTCGCCCAGACTGGAGTGCAGGG + Intronic
1179044985 21:37835831-37835853 AAAGCCCACACTGGAGGGTTAGG - Intronic
1179522952 21:41957091-41957113 GCAGAAGACACTGGAGGGCTGGG + Intergenic
1179723271 21:43327541-43327563 GCCGCCCAGGCTGGAGTGCAGGG - Intergenic
1180967296 22:19797303-19797325 TCCGCCCACTCTGCTGGGCTGGG - Intronic
1181307540 22:21925499-21925521 GCGGGCCACACTCGAGGCCTGGG + Intronic
1181398966 22:22639723-22639745 GCGCCCTACACTGGTGGGCTGGG + Intergenic
1181650452 22:24256336-24256358 GCGGCCTACACTGGTGGGCTGGG - Intergenic
1181706926 22:24654402-24654424 GCGCCCTACACTGGTGGGCTGGG + Intergenic
1182476758 22:30580741-30580763 CCCACCCCCACTGGAGGGCCAGG + Intronic
1183050689 22:35258007-35258029 GCCGCGGCCACGGGAGGGCTGGG + Intronic
1183910490 22:41075346-41075368 GTTGCCCACACTGGAGTGCAGGG + Intergenic
1184826206 22:46953055-46953077 GCAGCCCACACTGAACGGGTGGG + Intronic
1184921779 22:47610334-47610356 GCAGCCCAGGATGGAGGGCTGGG - Intergenic
1185149727 22:49157233-49157255 GCCTCTAACACTGAAGGGCTAGG - Intergenic
1185207110 22:49546245-49546267 GCTGCCCACACTGAAGGGGAGGG - Intronic
949765001 3:7516436-7516458 GCCGCCCAGGCTGGAGTGCAGGG - Intronic
952943401 3:38459802-38459824 GCAGCCGACACTGGAGGCCCTGG + Intronic
954645730 3:52130506-52130528 GCAGCCCAGAGTTGAGGGCTGGG - Intronic
954743842 3:52775419-52775441 GCCCAACACACTGCAGGGCTTGG + Intergenic
961675369 3:128561851-128561873 GAAGCCCACACTTGAGGGGTGGG - Intergenic
962255279 3:133866229-133866251 GCCGCCCAGAGTTGAGGGCTGGG - Intronic
962255485 3:133867421-133867443 GCCACCCAGAGTTGAGGGCTGGG - Intronic
963122558 3:141788499-141788521 GCTGTCCTCAGTGGAGGGCTAGG + Intronic
964329160 3:155582118-155582140 GCCGCCCAGGCTGGAGTGCAGGG + Intronic
967867432 3:194201876-194201898 GCCACCCACACTGGAGGGAAGGG - Intergenic
968704107 4:2070059-2070081 GCCCCTCAGCCTGGAGGGCTAGG + Intergenic
968804829 4:2765693-2765715 GTCGCCCACACTGGAGGGAGTGG + Intergenic
968945421 4:3661129-3661151 GCCACCCACTGTGGAAGGCTGGG - Intergenic
975341799 4:73250743-73250765 GTCGCCCAGACTGGAGTGCAAGG + Intronic
977331546 4:95643182-95643204 GCCTCCCACACTAGAAGGATGGG - Intergenic
980025475 4:127760921-127760943 CCCGCCCAGGCTGGAGTGCTGGG - Intronic
982468490 4:155759438-155759460 GCCTCCCACACTGGTGGGGCCGG - Intronic
985939249 5:3121389-3121411 GAGACCCACAATGGAGGGCTGGG + Intergenic
986476107 5:8135157-8135179 GCAGCCCACACTTAAGGGATGGG - Intergenic
986919060 5:12662178-12662200 GCCCACCACAGTGGGGGGCTTGG - Intergenic
989120921 5:38003877-38003899 GCCGTGCTTACTGGAGGGCTCGG - Intergenic
995512195 5:112921318-112921340 GCCGCCCACACCGCGAGGCTGGG + Intronic
995725871 5:115179900-115179922 GACGCCCACAGTGGCGGGCCAGG + Intronic
997244540 5:132335950-132335972 GCTGCCCACTCTGGAGGCCGTGG - Exonic
997583699 5:135032898-135032920 GGCGCCCACACCGGGGAGCTCGG + Intronic
999759379 5:154688613-154688635 GCCGCCCAGGCTGGAGTGCAGGG - Intergenic
1000052468 5:157575122-157575144 GCCTGCCACACTGGTGGGGTAGG - Intronic
1000564602 5:162832382-162832404 GCCACCCAGGCTGGAGGGCAGGG + Intergenic
1000594529 5:163199089-163199111 GCAGCCCACACTTAAGGACTGGG - Intergenic
1001575070 5:172757974-172757996 CCAGCCCCCACTGCAGGGCTAGG - Intergenic
1002603764 5:180370193-180370215 GCCTCCCACAATGGAGGGCATGG - Intergenic
1002608369 5:180397356-180397378 GCCGCCCAGGCTGGAGTGCAGGG + Intergenic
1003562726 6:7196140-7196162 GCAGGCAACACCGGAGGGCTGGG - Intronic
1004224931 6:13776486-13776508 GTCGCCCAGGCTGGAGTGCTGGG - Intergenic
1016960678 6:149669718-149669740 GTCGCCCACGCTGGAGTGCAGGG - Intronic
1019716400 7:2541380-2541402 GCCCCCCACACTGGAGGCAGGGG + Exonic
1019797667 7:3063742-3063764 GCCGCCTAGACTGGAGTGCAGGG + Intergenic
1019985811 7:4654916-4654938 GTCGCCCAGACTGGAGTGCAAGG + Intergenic
1020080816 7:5284756-5284778 GCCACCCACACTGCCCGGCTTGG - Intronic
1020277285 7:6632423-6632445 GTCGCCCATACTGGAGTGCAGGG + Intergenic
1020289059 7:6708583-6708605 GCCGCCCAGGCTGGAGTGCAGGG + Intergenic
1022495259 7:30849142-30849164 GCTGCCCACTGTGGTGGGCTGGG + Intronic
1022502642 7:30892310-30892332 GCCAACCACATTGGAGGCCTGGG - Exonic
1023063635 7:36353238-36353260 GTCGCCCAGGCTGGAGAGCTGGG - Intronic
1026858554 7:73770307-73770329 ACCGCCCCCACCGGAGCGCTGGG - Intergenic
1028428913 7:90723628-90723650 GCAGCCCACACTCAAGAGCTGGG + Intronic
1031245735 7:119308825-119308847 GTCGCCCAGACTGGAGTGCAGGG - Intergenic
1035133169 7:156674633-156674655 GTCACCCAAACTGGAGTGCTTGG - Intronic
1035784831 8:2252294-2252316 GCTACCCACACTTGAGGGCCGGG - Intergenic
1035807976 8:2469427-2469449 GCTACCCACACTTGAGGGCCGGG + Intergenic
1036712921 8:11093473-11093495 GCCACCCACAGTGGAGTGCGGGG - Intronic
1040078841 8:43267730-43267752 GTCCCCCACACTGGAGTGCAGGG + Intergenic
1040914208 8:52552455-52552477 TCAGCCCACACTTGAGGACTGGG + Intronic
1042673793 8:71294418-71294440 GTCGCCCAGGCTGGAGGGCGTGG - Intronic
1043502867 8:80874003-80874025 GCTGCCCAGGCTGGAGCGCTTGG + Intronic
1044569443 8:93700701-93700723 GCCGCCCACACTGGAGGGCTGGG + Intronic
1047833593 8:128662742-128662764 GCCGCCCAGGCTGGAGTGCGTGG - Intergenic
1049307930 8:141917174-141917196 CACGCCCACATTGGAGGGCTTGG + Intergenic
1051431639 9:16985743-16985765 GCCGCCCTCATTGAAGGGTTTGG + Intergenic
1056554659 9:87678440-87678462 CCCACGGACACTGGAGGGCTGGG + Intronic
1056760289 9:89409680-89409702 AGTGCCCACACCGGAGGGCTAGG + Intronic
1056932799 9:90892783-90892805 GAGGCCCCCACTGGAGGGCTGGG - Intronic
1057215650 9:93227017-93227039 GCAGCCCTCAGAGGAGGGCTTGG - Intronic
1057880598 9:98790250-98790272 GCCGCACTCACTGGGCGGCTTGG - Exonic
1059387121 9:113973286-113973308 GAAGCCCACGTTGGAGGGCTGGG - Intronic
1059865682 9:118511479-118511501 GTCGCCCACGCTGGAGTGCACGG - Intergenic
1060668879 9:125450969-125450991 GCTGCCCACGCAGGAGTGCTTGG - Intronic
1062322928 9:135999136-135999158 GCTGCCCACAGTGGAGGGGTGGG - Intergenic
1062412858 9:136433583-136433605 GCCGCCCACACAGGTGCTCTGGG - Intronic
1187989939 X:24859354-24859376 GCCTGCCGCACTGGAGAGCTTGG + Intronic
1188616482 X:32164802-32164824 GCCGCACACAGTGGTGGGGTTGG - Intronic
1189342860 X:40217848-40217870 GTCGCCCAGACTGGAGTGCAGGG + Intergenic
1190653530 X:52591093-52591115 GGAGGCCACACTGGAGGCCTTGG + Intergenic
1192122642 X:68471551-68471573 GCCGCCCAGGCTGGAGTGCACGG + Intergenic
1195668132 X:107449038-107449060 GCCGCTCACACTCCAGTGCTGGG + Intergenic
1202036991 Y:20646003-20646025 CCCACCCACACTGCAGGACTGGG - Intergenic