ID: 1044569445

View in Genome Browser
Species Human (GRCh38)
Location 8:93700702-93700724
Sequence CCGCCCACACTGGAGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7005
Summary {0: 1, 1: 0, 2: 7, 3: 308, 4: 6689}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044569434_1044569445 -3 Left 1044569434 8:93700682-93700704 CCGAGCCCAGCTGCCCAGGGCCG 0: 1
1: 0
2: 7
3: 59
4: 531
Right 1044569445 8:93700702-93700724 CCGCCCACACTGGAGGGCTGGGG 0: 1
1: 0
2: 7
3: 308
4: 6689
1044569436_1044569445 -9 Left 1044569436 8:93700688-93700710 CCAGCTGCCCAGGGCCGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 426
Right 1044569445 8:93700702-93700724 CCGCCCACACTGGAGGGCTGGGG 0: 1
1: 0
2: 7
3: 308
4: 6689
1044569429_1044569445 17 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569445 8:93700702-93700724 CCGCCCACACTGGAGGGCTGGGG 0: 1
1: 0
2: 7
3: 308
4: 6689
1044569435_1044569445 -8 Left 1044569435 8:93700687-93700709 CCCAGCTGCCCAGGGCCGCCCAC 0: 1
1: 0
2: 0
3: 42
4: 376
Right 1044569445 8:93700702-93700724 CCGCCCACACTGGAGGGCTGGGG 0: 1
1: 0
2: 7
3: 308
4: 6689
1044569433_1044569445 -2 Left 1044569433 8:93700681-93700703 CCCGAGCCCAGCTGCCCAGGGCC 0: 1
1: 5
2: 16
3: 75
4: 777
Right 1044569445 8:93700702-93700724 CCGCCCACACTGGAGGGCTGGGG 0: 1
1: 0
2: 7
3: 308
4: 6689
1044569428_1044569445 18 Left 1044569428 8:93700661-93700683 CCCTGGAAAACCGGTAACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1044569445 8:93700702-93700724 CCGCCCACACTGGAGGGCTGGGG 0: 1
1: 0
2: 7
3: 308
4: 6689
1044569430_1044569445 8 Left 1044569430 8:93700671-93700693 CCGGTAACAGCCCGAGCCCAGCT 0: 1
1: 0
2: 1
3: 2
4: 121
Right 1044569445 8:93700702-93700724 CCGCCCACACTGGAGGGCTGGGG 0: 1
1: 0
2: 7
3: 308
4: 6689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044569445 Original CRISPR CCGCCCACACTGGAGGGCTG GGG Intronic
Too many off-targets to display for this crispr