ID: 1044569448

View in Genome Browser
Species Human (GRCh38)
Location 8:93700707-93700729
Sequence CACACTGGAGGGCTGGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 934
Summary {0: 1, 1: 0, 2: 8, 3: 93, 4: 832}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044569436_1044569448 -4 Left 1044569436 8:93700688-93700710 CCAGCTGCCCAGGGCCGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 426
Right 1044569448 8:93700707-93700729 CACACTGGAGGGCTGGGGTGAGG 0: 1
1: 0
2: 8
3: 93
4: 832
1044569434_1044569448 2 Left 1044569434 8:93700682-93700704 CCGAGCCCAGCTGCCCAGGGCCG 0: 1
1: 0
2: 7
3: 59
4: 531
Right 1044569448 8:93700707-93700729 CACACTGGAGGGCTGGGGTGAGG 0: 1
1: 0
2: 8
3: 93
4: 832
1044569433_1044569448 3 Left 1044569433 8:93700681-93700703 CCCGAGCCCAGCTGCCCAGGGCC 0: 1
1: 5
2: 16
3: 75
4: 777
Right 1044569448 8:93700707-93700729 CACACTGGAGGGCTGGGGTGAGG 0: 1
1: 0
2: 8
3: 93
4: 832
1044569435_1044569448 -3 Left 1044569435 8:93700687-93700709 CCCAGCTGCCCAGGGCCGCCCAC 0: 1
1: 0
2: 0
3: 42
4: 376
Right 1044569448 8:93700707-93700729 CACACTGGAGGGCTGGGGTGAGG 0: 1
1: 0
2: 8
3: 93
4: 832
1044569429_1044569448 22 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569448 8:93700707-93700729 CACACTGGAGGGCTGGGGTGAGG 0: 1
1: 0
2: 8
3: 93
4: 832
1044569430_1044569448 13 Left 1044569430 8:93700671-93700693 CCGGTAACAGCCCGAGCCCAGCT 0: 1
1: 0
2: 1
3: 2
4: 121
Right 1044569448 8:93700707-93700729 CACACTGGAGGGCTGGGGTGAGG 0: 1
1: 0
2: 8
3: 93
4: 832
1044569428_1044569448 23 Left 1044569428 8:93700661-93700683 CCCTGGAAAACCGGTAACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1044569448 8:93700707-93700729 CACACTGGAGGGCTGGGGTGAGG 0: 1
1: 0
2: 8
3: 93
4: 832

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044569448 Original CRISPR CACACTGGAGGGCTGGGGTG AGG Intronic
900136605 1:1120334-1120356 CACAGTGGTGAGCAGGGGTGGGG + Intergenic
900177927 1:1298923-1298945 GTCCCTGCAGGGCTGGGGTGGGG - Intronic
900558795 1:3293329-3293351 CACACGGGTGGCCTGGGATGCGG - Intronic
900611794 1:3547346-3547368 CACACTGAAGGCCCGGGGAGAGG - Intronic
900996959 1:6127979-6128001 CACAGTGGGGGGCGGGGCTGCGG + Intronic
901001632 1:6151791-6151813 CCCACCGCAGGGCTGGGGTGAGG + Intronic
901027252 1:6285162-6285184 GACCCACGAGGGCTGGGGTGTGG + Intronic
901490733 1:9595142-9595164 GACACTGGGGGACTGGGGAGGGG - Intronic
901946937 1:12711791-12711813 CCCACTGGGGGTCTCGGGTGGGG + Intergenic
903060278 1:20664284-20664306 AACACTGGTGGGCATGGGTGTGG + Exonic
903259030 1:22121342-22121364 ACCACTGGAAGCCTGGGGTGTGG + Exonic
903326873 1:22573863-22573885 CACCCAGGAGGGCTGGGAAGGGG + Intronic
903813085 1:26045718-26045740 CATGCAGGAGGGGTGGGGTGAGG - Intronic
904098906 1:28005668-28005690 CAGACTGGAGTGCAGTGGTGTGG - Intronic
904494485 1:30878898-30878920 CACAGGGCAGGGGTGGGGTGTGG + Intronic
905192381 1:36245412-36245434 CACTCTGGGAGGCTGAGGTGGGG - Intronic
905219022 1:36431181-36431203 GAGTCTGGAGGGCAGGGGTGGGG + Intronic
905372366 1:37490156-37490178 CACACAGGATGGCTGGGTGGGGG - Intergenic
905460946 1:38122751-38122773 CACACTGGAGGGTGGGGTTGGGG + Intergenic
905481323 1:38264055-38264077 CACACTGGAGCATCGGGGTGAGG - Intergenic
905770906 1:40637211-40637233 CCCAATGGTGGGCTGGGGAGGGG + Intronic
906302728 1:44695272-44695294 CCCACTGGAGGGCCATGGTGAGG + Intronic
906396142 1:45466603-45466625 CAGACTGGAGTGCAGTGGTGTGG - Intronic
906483083 1:46213611-46213633 CACTCTGGGAGGCTGAGGTGAGG + Intronic
906576278 1:46893276-46893298 CACTCTGGACTACTGGGGTGGGG + Intergenic
906595643 1:47074311-47074333 CACTCTGGACTACTGGGGTGGGG - Intronic
906747023 1:48229149-48229171 CACACGGGAGGACTGGGGTCAGG + Exonic
907145816 1:52230324-52230346 CACACTGGGAGGACGGGGTGGGG - Intronic
908106285 1:60846003-60846025 CACACTGGAGTCGGGGGGTGAGG + Intergenic
908704050 1:66930931-66930953 CAACCTGGAGGGCTGGATTGCGG - Intronic
910112006 1:83692966-83692988 CAAAATGGGGGGCAGGGGTGGGG - Intergenic
910298671 1:85680159-85680181 CACGCTGGAGTGCAGTGGTGCGG - Intronic
910345134 1:86227955-86227977 CAAACTGAAAAGCTGGGGTGGGG - Intergenic
910918671 1:92319519-92319541 CACTGTGGAAGGCTGAGGTGGGG + Intronic
910928259 1:92418189-92418211 GACACTGCAGGACTGGGGTCAGG - Intergenic
910939999 1:92523002-92523024 CACCTTGGAAGGCTGAGGTGAGG - Intronic
910965355 1:92802916-92802938 CACTTTGGAAGGCTGGGGAGGGG + Intergenic
911001475 1:93170499-93170521 CACAGTGGGGGGCTGAGGGGAGG - Intronic
911018271 1:93358505-93358527 CAGAGTGGGGGGATGGGGTGCGG - Intronic
911453325 1:98093546-98093568 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
912511009 1:110190158-110190180 CACAGGGGTGGGCTGGGGAGAGG + Intronic
912801071 1:112720056-112720078 CACACCAGAGGGCTGGAATGGGG - Intergenic
913196173 1:116458017-116458039 CACAAGGGAGGGGTGGGCTGGGG - Intergenic
913335176 1:117703219-117703241 CACAGTGGAGGGCGGGGAGGGGG + Intergenic
913385311 1:118252694-118252716 CACACTGCCTGGCTGCGGTGGGG + Intergenic
913385377 1:118253222-118253244 GACTCTGGAGGCCTGGGCTGGGG + Intergenic
913537219 1:119784664-119784686 CAGAGATGAGGGCTGGGGTGTGG - Intergenic
914050517 1:144126611-144126633 CACAGTGCAGGGCTGTGGTGGGG + Intergenic
914128665 1:144838834-144838856 CACAGTGCAGGGCTGTGGTGGGG - Intergenic
915473445 1:156138946-156138968 CAGACTGGAGGGCAGGGGCAGGG + Intronic
916215924 1:162394649-162394671 GACTCTGGTGGGGTGGGGTGGGG - Intergenic
916277248 1:163008148-163008170 CACTTTGGAAGGCTGAGGTGGGG + Intergenic
916446861 1:164880725-164880747 CACACTAGAGGGCTTGGGAGGGG - Intronic
917557198 1:176102101-176102123 CACACTGAGAGGATGGGGTGGGG + Intronic
917653044 1:177097750-177097772 CTCACTGAAGGTCTGGGGTGGGG - Intronic
918161237 1:181902056-181902078 CACACTGGGAGGATGGGGTGAGG + Intergenic
918469039 1:184851461-184851483 CACACTTGGGGACTGTGGTGGGG + Intronic
918581084 1:186130595-186130617 TCCACTGGATGGTTGGGGTGGGG - Exonic
918821385 1:189259892-189259914 CTTTCTGGAGGGCTGGTGTGGGG + Intergenic
919262454 1:195214672-195214694 CACACAGGAGGGATGAAGTGGGG - Intergenic
920342607 1:205284882-205284904 CAGGCTGGAGGGGTGGGGAGGGG - Intergenic
920415661 1:205797818-205797840 AACCCTGGAGAGATGGGGTGGGG - Intronic
921097500 1:211899865-211899887 CACTTTGGAAGGCTGAGGTGGGG + Intergenic
921990443 1:221360359-221360381 TACTTTGGAGGGCTGAGGTGAGG - Intergenic
922295132 1:224243414-224243436 CAGGCTGGAGGGCAGTGGTGCGG - Intronic
922351103 1:224735148-224735170 GCCACTGTGGGGCTGGGGTGGGG - Intronic
923198371 1:231689374-231689396 CAGACTGGAGTGCAGTGGTGTGG + Intronic
923312453 1:232748099-232748121 CTCTCTGGGGGGCTGTGGTGGGG + Intergenic
923333908 1:232950691-232950713 CATACTGGTGGGCGGGGGTAGGG - Exonic
923446889 1:234080093-234080115 CTCCCTGGAGGTCGGGGGTGGGG - Intronic
924351210 1:243116162-243116184 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
924819241 1:247472398-247472420 CACACTGGAGTGTTTGGGAGGGG + Intergenic
1062831314 10:607918-607940 CACACTGAGGGGCTGTGGTGTGG - Intronic
1063381940 10:5591055-5591077 CAGCCTGGAGGGCCTGGGTGAGG - Intergenic
1063674259 10:8126102-8126124 CAGACTGGAGAGCAGTGGTGTGG + Intergenic
1063685713 10:8235712-8235734 CAACCAGGAGGGCAGGGGTGGGG + Intergenic
1064315711 10:14254113-14254135 TTCAATGGAGGGCTGAGGTGGGG - Intronic
1064330273 10:14387388-14387410 CAGGCTGGAGTGCTGGAGTGCGG - Intronic
1064543580 10:16429375-16429397 CAGACTGGAGTGCAGTGGTGAGG + Intergenic
1065020112 10:21496250-21496272 CACTGGGGAGGGCTGGGGTGCGG - Intronic
1065905315 10:30245685-30245707 CAGACTGGAGTGCAGTGGTGCGG - Intergenic
1066303506 10:34117425-34117447 CAGACTGGAGGGCAGTGGGGAGG + Intronic
1067021450 10:42803064-42803086 CAGACTGGAGTGCTATGGTGTGG + Intronic
1067111425 10:43403945-43403967 CACACTGGAGTGCCCTGGTGTGG - Intronic
1067242525 10:44508627-44508649 CTCACTGAAGGGATGAGGTGAGG + Intergenic
1067317733 10:45184146-45184168 AACACAGGAGGGCAGAGGTGAGG + Intergenic
1067414629 10:46094136-46094158 AACACAGGAGGGGTGGGGCGGGG + Intergenic
1067525637 10:47036731-47036753 CACAGTGGGGTGGTGGGGTGTGG - Intergenic
1068017887 10:51541112-51541134 CACAGAGCAGGGTTGGGGTGGGG + Intronic
1068224139 10:54084426-54084448 CAGACTGGAGAGCTGTGGTATGG - Intronic
1069006270 10:63320929-63320951 CTCCCTGGAGGTCTGGGGTGGGG - Intronic
1069581238 10:69568542-69568564 GAGAGTGGAGGGGTGGGGTGGGG - Intergenic
1069749486 10:70736254-70736276 CTCGTTGGAGTGCTGGGGTGGGG + Intronic
1070122753 10:73594631-73594653 TAAACTGGAGGATTGGGGTGGGG + Intronic
1070788516 10:79176093-79176115 CACAATGGAGGGAGGGGATGGGG + Intronic
1072970913 10:100016617-100016639 CACTCTGGGAGGCTGAGGTGGGG + Intergenic
1073057043 10:100709712-100709734 GGAACTGGAAGGCTGGGGTGGGG - Intergenic
1073057571 10:100712195-100712217 CACTCTGGAGAGGTGGGGTGGGG - Intergenic
1073101383 10:101008505-101008527 GAGTCTGGAGGGCTGGGGAGGGG + Intronic
1073138414 10:101232157-101232179 CACACCATATGGCTGGGGTGTGG + Intergenic
1073228231 10:101943067-101943089 CACACTGCAGGGTTGGGAAGAGG + Intronic
1073250384 10:102117557-102117579 CACACTGGAGGCCTGGGTCAGGG - Intronic
1073423946 10:103445051-103445073 CATAGTGAAGGGCTTGGGTGAGG - Intronic
1074840611 10:117347057-117347079 CACACAGGAGGGGTGGGTTTAGG - Intronic
1074848707 10:117421402-117421424 GACACTAAATGGCTGGGGTGGGG - Intergenic
1075158418 10:120001123-120001145 CACAATTAAGGGCGGGGGTGGGG - Intergenic
1075395621 10:122124959-122124981 CACACTGGGGGGCTGGGAGGGGG - Intronic
1075407722 10:122205673-122205695 CCTTCTGCAGGGCTGGGGTGGGG - Intronic
1075486808 10:122829207-122829229 CAAACTAGAGGGGCGGGGTGGGG - Intergenic
1075626327 10:123966739-123966761 CTCAGTGGGGGGATGGGGTGGGG - Intergenic
1075751370 10:124774328-124774350 CAGGCTGGAGGGCTGGAGTGCGG - Intronic
1076050521 10:127329531-127329553 GACACTGGGGTGCTGGGGCGGGG + Intronic
1076441762 10:130485354-130485376 CACCCTGCTGGGCTGGGGTCTGG - Intergenic
1076505519 10:130970547-130970569 CACAGTGGATGGCAGAGGTGGGG - Intergenic
1076917097 10:133429652-133429674 CACACTGGGTGGCTGTGATGAGG + Intergenic
1076937191 10:133574409-133574431 CACACTGGGTGGCTGTGATGAGG + Intergenic
1077094022 11:791804-791826 CCGACGGGAGGGCTGGGGAGGGG + Exonic
1077140449 11:1021994-1022016 CAGACTTGTGGGGTGGGGTGTGG - Intronic
1077466460 11:2735959-2735981 CACACTGGAGGAAGGGCGTGGGG - Intronic
1077492339 11:2867482-2867504 TGGTCTGGAGGGCTGGGGTGTGG - Intergenic
1077556731 11:3229675-3229697 CAAGCTGGAGGGCTGGGGACTGG - Intronic
1077754723 11:5014652-5014674 CACTTTGGAAGGCTGAGGTGGGG + Intergenic
1078062513 11:8057076-8057098 GGCTCTGGAGGGCTGGGGAGGGG + Intronic
1078159997 11:8832097-8832119 CACTCTGGAAGGCGGGGGTGAGG - Intronic
1078327671 11:10393753-10393775 GAAAGAGGAGGGCTGGGGTGAGG + Intronic
1078558926 11:12354022-12354044 CACCCTTTAGGGATGGGGTGGGG - Intronic
1078703655 11:13716950-13716972 CACACTGGGGGCCTGTCGTGGGG - Intronic
1079022804 11:16923508-16923530 CTCCCTGGAAGGCTGGAGTGAGG + Intronic
1079764186 11:24370031-24370053 CACACTGGAGCCCGTGGGTGAGG - Intergenic
1079943337 11:26710025-26710047 CACACTGGAGGCCTGTGGGTGGG - Intronic
1080009171 11:27440237-27440259 CACAGTGGAGGGGTGTGGAGAGG + Intronic
1080457036 11:32427503-32427525 AACCCTGGAGGGTTGAGGTGGGG + Intronic
1080641113 11:34158906-34158928 GATGCAGGAGGGCTGGGGTGGGG + Intronic
1081502815 11:43682826-43682848 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1081673542 11:44955211-44955233 CACTCTGGAGGGGTGGGGGCAGG - Intergenic
1081739821 11:45430937-45430959 CCTACTGGAGGGCTGGGCGGGGG + Intergenic
1081913986 11:46719340-46719362 CAGGCTGGAGGACTGGGGTGTGG + Intronic
1082005495 11:47416754-47416776 CACACTGGAGTGCAGTGGTGCGG + Intergenic
1082808271 11:57463526-57463548 CACCATTGAGGGCTGGGGAGGGG - Intronic
1082841390 11:57692957-57692979 CACAGATGGGGGCTGGGGTGGGG + Intronic
1083049834 11:59767181-59767203 CACACTTGAGGGGTAGGGTCGGG + Intronic
1083261594 11:61525996-61526018 CAGCCTGGAGGCCTGAGGTGAGG + Intronic
1083304789 11:61756603-61756625 CCCAGTGCAGGGCAGGGGTGGGG + Intronic
1083319208 11:61834985-61835007 CAGGGAGGAGGGCTGGGGTGGGG - Intronic
1083592709 11:63904780-63904802 CACGCTGGGGGGCTGTGCTGTGG - Exonic
1083769001 11:64856047-64856069 CACCCCGCAGGGCTGTGGTGAGG - Intronic
1084192597 11:67505604-67505626 CACACAGGAGGGCTGGGCTAGGG - Intronic
1084274047 11:68042884-68042906 GAGACTGGGGGGCTGGGGAGGGG + Intronic
1084403050 11:68956076-68956098 CAGGATGGAGGGTTGGGGTGGGG + Intergenic
1084651284 11:70490855-70490877 CACACTGTGGGGCTGGTGTCAGG - Intronic
1084713503 11:70858994-70859016 CACACTGGAGCACTGGTGTTGGG + Intronic
1084933488 11:72574894-72574916 CTCAAAGGAGGGCTGGGCTGGGG + Intergenic
1084962552 11:72724943-72724965 TACCCTGGAGCCCTGGGGTGTGG + Intronic
1085002480 11:73052889-73052911 CAGACTGGAGAGCAGTGGTGTGG + Intronic
1085291968 11:75407381-75407403 CACTCTGGAAGGCCGAGGTGGGG - Intronic
1086542706 11:87931930-87931952 TGCACAGGAGGGGTGGGGTGGGG + Intergenic
1087094684 11:94307476-94307498 CACACAGGTCAGCTGGGGTGGGG - Exonic
1087155294 11:94895916-94895938 CAGCCTGGAGGGCTGGGCTGGGG - Intergenic
1087290991 11:96320297-96320319 CACACTGGGAGGCTGGAGTAAGG + Intronic
1088107585 11:106223950-106223972 CCCACTGGGGGTCTTGGGTGGGG - Intergenic
1088337339 11:108720836-108720858 CACTTTGGAAGGCTGAGGTGGGG - Intronic
1088581745 11:111323255-111323277 CACTCGGGAGGTCTGGGGTCGGG + Intergenic
1088801506 11:113311533-113311555 CCCAGTGGAGTGCTGGGCTGGGG + Intergenic
1088808568 11:113373701-113373723 CACACTGCAGGGCTGAGGCTTGG - Intronic
1089111788 11:116063108-116063130 GACAGGGGAGGGATGGGGTGAGG + Intergenic
1089316809 11:117597342-117597364 CAAACTGGGGGGCAGGTGTGTGG + Intronic
1089553398 11:119299618-119299640 CTCACTGGAGAGCTGAGGTGAGG - Exonic
1089861073 11:121590486-121590508 GACTCTGTAGGTCTGGGGTGAGG - Intronic
1090364287 11:126193004-126193026 CAGGCTGGAGGTCTGGGATGAGG + Intergenic
1090414035 11:126528448-126528470 CACAGTGGAGAGCTGGGGACAGG + Intronic
1090699852 11:129283784-129283806 GAGGCTGGAGGGCTGGGGAGAGG - Intergenic
1091046445 11:132329985-132330007 CACATAGGAGGGCTGGGCAGTGG + Intronic
1091395762 12:153451-153473 CTCACTGGAGAGCTGGGGGTTGG - Intronic
1092210163 12:6640577-6640599 CACCCTGGAGGGCTGAGGCATGG - Intronic
1092228638 12:6765104-6765126 CAGAGTGGAAGGCTGGGGTTTGG - Intronic
1092283415 12:7114469-7114491 CACACCAGAGGGTTGGTGTGAGG + Intergenic
1092680454 12:10974266-10974288 CACACTCGTAGACTGGGGTGGGG - Intronic
1095385576 12:41646049-41646071 CACAGTGGGGGGCCAGGGTGAGG - Intergenic
1095805945 12:46321477-46321499 CTCTCTGGTGGGCAGGGGTGGGG + Intergenic
1095811282 12:46374694-46374716 CAAAGTGGAGGGCAGGGGCGGGG + Intergenic
1096262774 12:50103495-50103517 TCCACTGCAGGGCTGGGGTGGGG - Intergenic
1096424236 12:51487616-51487638 TACACTGCAGGGGTGGGGTAAGG + Intronic
1096490581 12:52010581-52010603 CTCACTGGAAAGCTGGGATGGGG + Intronic
1096782987 12:54001506-54001528 TGCACAGGAGGGCTAGGGTGGGG + Intronic
1096870755 12:54590670-54590692 CAGCCTGGATGTCTGGGGTGGGG - Intergenic
1096882061 12:54681154-54681176 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1097018882 12:56006362-56006384 CAGACTGGAGTGCAGGAGTGCGG + Intronic
1097254427 12:57662431-57662453 CTCACTGGAGTGCAGTGGTGTGG + Intergenic
1097751045 12:63353257-63353279 CACTTTGGGAGGCTGGGGTGGGG + Intergenic
1097773978 12:63624434-63624456 CATACTGCAGGGCTGGGCTGTGG - Intronic
1097829738 12:64211368-64211390 CACTTTGGAAGGCTGAGGTGGGG + Intronic
1098055851 12:66504286-66504308 CAAACTGGAGGGCATGGCTGTGG - Intronic
1098201291 12:68058666-68058688 CCTGCTGGAGGGCTGGGGAGAGG - Intergenic
1099192234 12:79572346-79572368 CACTCTGGAAGGCCGAGGTGGGG + Intergenic
1100012132 12:89966387-89966409 CACACTGGAGGTAAGAGGTGGGG + Intergenic
1100611756 12:96195936-96195958 CAGGCTGGAGGACTGGGGTGGGG - Intronic
1101490328 12:105204062-105204084 AACCCTGGAGGGCAGGGGTATGG + Intronic
1101865482 12:108516796-108516818 CTCACTAGAGAGATGGGGTGGGG - Intronic
1102390504 12:112545457-112545479 CACTCTGAGAGGCTGGGGTGTGG + Intergenic
1102560399 12:113758010-113758032 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1103197640 12:119059028-119059050 CACAGAGGAGGGCTGGGCAGAGG - Intronic
1103527609 12:121578645-121578667 AGCACTGGGGGGGTGGGGTGGGG - Intronic
1104676856 12:130716990-130717012 GCCACTGGAGGCTTGGGGTGGGG - Intergenic
1105404534 13:20122269-20122291 CACTTTGGGAGGCTGGGGTGGGG + Intergenic
1105743025 13:23348630-23348652 CAGACTGCAGGGCAGGGGTGAGG + Intronic
1105993798 13:25650126-25650148 CCAACTTGAGGGATGGGGTGGGG + Intronic
1106117463 13:26829852-26829874 CACACAGTGGGGCTGGGGAGGGG + Intergenic
1106558963 13:30832823-30832845 CACGCAGGAGGGTGGGGGTGGGG - Intergenic
1106583749 13:31039150-31039172 CACAGTGGAGGGCTGGCCTCAGG + Intergenic
1106666220 13:31853212-31853234 CAGACTGGAGTGCAGCGGTGCGG - Intergenic
1107433661 13:40362646-40362668 CAGACTGTGGGGCAGGGGTGGGG - Intergenic
1108635236 13:52327279-52327301 CACGCTGGAGTGCAGTGGTGTGG - Intergenic
1108652573 13:52495950-52495972 CACGCTGGAGTGCAGTGGTGTGG + Intergenic
1111983099 13:95037908-95037930 CAGACTGGAGTGCAGTGGTGTGG + Intronic
1112275869 13:98018902-98018924 CACCCTGGAAGGCTGGGGGCAGG - Intronic
1112326581 13:98445955-98445977 CACACGGGGGAGCGGGGGTGGGG + Intronic
1112488897 13:99844328-99844350 CACACTGCAGGACTGTTGTGAGG + Intronic
1113264190 13:108599001-108599023 CACACTCTGGGGATGGGGTGGGG - Intronic
1113832725 13:113309344-113309366 CACTCTGGGAGGCTGAGGTGGGG - Intronic
1113924422 13:113932907-113932929 CACACTGGAGTGCAGTGGCGTGG + Intergenic
1113962391 13:114133053-114133075 CATGCCGGAGGTCTGGGGTGGGG - Intergenic
1114132121 14:19803020-19803042 CAGGCTGGAGGGCAGTGGTGCGG + Intronic
1114537672 14:23433238-23433260 CTGACAGGAGGGCTTGGGTGGGG - Intronic
1115991301 14:39153380-39153402 CACACTGGGAGGCCGAGGTGAGG + Intronic
1117052374 14:51874179-51874201 CACTTTGGAAGGCTGAGGTGGGG + Intronic
1117260453 14:54027844-54027866 CACACTGGGGGCCTGTCGTGGGG - Intergenic
1117322862 14:54640702-54640724 GACAATTGAGGGCTGGGGTGAGG - Intronic
1117423633 14:55573269-55573291 CTCTCTGGGGGGTTGGGGTGTGG - Intronic
1117442282 14:55771326-55771348 CACACTGGTGGTCTGGAGAGAGG + Intergenic
1117462947 14:55964298-55964320 TACACTGGAGGGTTGGAGTAGGG - Intergenic
1117880578 14:60309444-60309466 CAAAATGAAAGGCTGGGGTGGGG - Intergenic
1118747101 14:68782202-68782224 CACATTATAGGGCTGTGGTGAGG - Intergenic
1118910809 14:70060460-70060482 TACAGTGTAGGGGTGGGGTGGGG + Intronic
1118983378 14:70733418-70733440 GAGACAGGAGGCCTGGGGTGAGG - Intronic
1119205231 14:72789004-72789026 CTCACTGGAGGGCTGGACTGGGG - Intronic
1119304123 14:73593381-73593403 CACGCTGGAGTGCAGTGGTGTGG + Intronic
1120836299 14:89040969-89040991 CACACTTGAGGGCTGGCGTTGGG + Intergenic
1121228950 14:92342285-92342307 GATACAGGAGGTCTGGGGTGGGG + Intronic
1121733029 14:96199527-96199549 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1122251282 14:100441566-100441588 CACACAGGAGAGCTTGGCTGGGG + Intronic
1122268222 14:100556616-100556638 TGCACTGTAGGGCTGGGGTGAGG - Intronic
1122548710 14:102538811-102538833 CCCCCTTGAGGGCTGTGGTGAGG - Intergenic
1122705012 14:103615437-103615459 GCCACTGGGGGGCTGGGGTGGGG - Intronic
1122807464 14:104267217-104267239 CACAGAGGAGGTCTGGGGTGAGG - Intergenic
1122880320 14:104687952-104687974 CACCCTGGAGGGCACGGGCGGGG - Intergenic
1123420392 15:20125921-20125943 CACGGTGCAGGGCTGTGGTGGGG + Intergenic
1123529616 15:21132457-21132479 CACGGTGCAGGGCTGTGGTGGGG + Intergenic
1123575202 15:21658738-21658760 CAGGCTGGAGGGCAGTGGTGCGG + Intergenic
1123611819 15:22101227-22101249 CAGGCTGGAGGGCAGTGGTGCGG + Intergenic
1124156950 15:27234337-27234359 CACACAGCAGGGCTGAGATGGGG - Intronic
1124455452 15:29838481-29838503 CACATTGGAGGGGCTGGGTGTGG - Intronic
1124945624 15:34262822-34262844 CGCACTGGTGGGAGGGGGTGAGG - Intronic
1125180735 15:36879026-36879048 CACACTAGAGAGCTGGGCTCAGG + Intergenic
1125502599 15:40248731-40248753 GACACAAGAGGGCTGGGGTGCGG - Intronic
1125774266 15:42197158-42197180 CACACTGGGGGCCTGTCGTGGGG + Intronic
1125931159 15:43601003-43601025 CACAATGCGGAGCTGGGGTGGGG + Exonic
1125944318 15:43700821-43700843 CACAATGCGGAGCTGGGGTGGGG + Intergenic
1126338494 15:47613688-47613710 CAGGCTGGAGTGCTGGAGTGTGG + Intronic
1126478009 15:49087608-49087630 CAGGCTGGAGGGCAGTGGTGTGG + Intergenic
1126686360 15:51252007-51252029 CACAGGGAAGGGCTGGGGAGGGG - Intronic
1127842654 15:62844394-62844416 CTCCCTGGAGGGCTGGGAGGTGG - Exonic
1127959642 15:63881232-63881254 CACACAGGAGGGCAGTGGCGTGG + Intergenic
1128188518 15:65666732-65666754 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1128291733 15:66483297-66483319 GTCACTGGAGGGGAGGGGTGGGG - Intronic
1128314680 15:66653209-66653231 CAGACTGGTGGGATCGGGTGTGG + Intronic
1128727497 15:69998900-69998922 CACACAGTGGGGCTGGGGAGTGG - Intergenic
1128935730 15:71745047-71745069 CACACTGGAAAGCTGGGCTATGG - Intronic
1129009377 15:72401297-72401319 CACTTTGGAAGGCTGAGGTGGGG + Intronic
1129029298 15:72606951-72606973 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1129147812 15:73664944-73664966 CACATTGGGAGGCTGAGGTGGGG - Intergenic
1129333850 15:74840997-74841019 CACATAGGAGGGGTGTGGTGGGG - Intronic
1129365642 15:75052299-75052321 CAGACTGGAGTGCAGTGGTGCGG + Intronic
1129497175 15:75995141-75995163 CATACTGGAGTGCAGTGGTGCGG - Intronic
1129802943 15:78430164-78430186 CACTTTGGGAGGCTGGGGTGGGG + Intergenic
1129877347 15:78984281-78984303 CACACATGCAGGCTGGGGTGGGG + Intronic
1129906623 15:79192091-79192113 CACTGTGCAGGCCTGGGGTGGGG + Intergenic
1130938374 15:88488759-88488781 CTCACTGAGGGGCTGGGGTAGGG - Intergenic
1131491862 15:92870048-92870070 CACATTTGAGGGCTGTGGGGAGG + Intergenic
1131510035 15:93044735-93044757 CACACTGCAGGGGCGGGGCGAGG + Intronic
1131619982 15:94057920-94057942 CACACTGGCATGCTGAGGTGTGG + Intergenic
1131956597 15:97742647-97742669 CGCACTGGAGGGGAAGGGTGGGG + Intergenic
1132074474 15:98808722-98808744 TACACTGGAGTGCAGTGGTGCGG + Intronic
1132203068 15:99968383-99968405 GAGACTTTAGGGCTGGGGTGGGG + Intergenic
1132351024 15:101139838-101139860 CAGAGTGGAGGGGTGGGGTAGGG - Intergenic
1202984070 15_KI270727v1_random:392982-393004 CAGGCTGGAGGGCAGTGGTGCGG + Intergenic
1132538628 16:496626-496648 GACACGGCAGTGCTGGGGTGAGG - Intronic
1132660396 16:1058468-1058490 CAGACGGGAGGGCGGGGGTTGGG - Intergenic
1132687960 16:1170169-1170191 CACCCGGGTGGGCTGGGGTCAGG - Intronic
1132788845 16:1673640-1673662 CACATCTGATGGCTGGGGTGAGG - Intronic
1133052614 16:3125789-3125811 CACATGGGGGGGTTGGGGTGGGG - Intergenic
1133402993 16:5502364-5502386 GACACTGTAGGGGTGGGATGTGG + Intergenic
1133670409 16:8013344-8013366 CACAGGGGTGGGCTGGGGGGAGG - Intergenic
1133967732 16:10543811-10543833 GACTCAGGAGGTCTGGGGTGGGG + Intronic
1133984114 16:10654940-10654962 CAGACTGGGGGGGGGGGGTGGGG - Intronic
1134092441 16:11398887-11398909 CACTTTGGAAGGCTGAGGTGGGG - Intronic
1134660766 16:15982759-15982781 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1134821957 16:17254082-17254104 CAGCCTGTAGGGCTGGTGTGGGG + Intronic
1135086193 16:19476300-19476322 CAAACTGGAGTGCAGTGGTGTGG - Intronic
1135170412 16:20178736-20178758 GGCTCTGGAGGGCTAGGGTGTGG - Intergenic
1136014045 16:27383600-27383622 GGCCCTGGAGGGCTGGGGGGAGG - Intergenic
1136467819 16:30457203-30457225 CAGACTGGAGTGCAGTGGTGCGG - Intergenic
1136537070 16:30906158-30906180 CACTTTGGAAGGCTGAGGTGGGG - Intergenic
1136721279 16:32320995-32321017 CACAGTGCAGGACTGTGGTGGGG + Intergenic
1136777298 16:32878777-32878799 CCCCCTGGAGGGGTGGGGTGGGG + Intergenic
1136839662 16:33527281-33527303 CACAGTGCAGGACTGTGGTGGGG + Intergenic
1136893327 16:33982736-33982758 CCCCCTGGAGGGGTGGGGTGGGG - Intergenic
1136910068 16:34137133-34137155 CACCCTGGAAGGGTGGAGTGTGG + Intergenic
1137423594 16:48357410-48357432 CACACTGGATGAGTGGGGAGGGG + Intronic
1138445743 16:57061896-57061918 CACACTGGAGGCCTGTGCTTTGG + Intronic
1138830352 16:60367468-60367490 CTCCCTGGAGGTCAGGGGTGGGG - Intergenic
1139019050 16:62725109-62725131 CTCAGCGGAGGGCGGGGGTGTGG - Intergenic
1139258182 16:65563464-65563486 CACTTTGGGAGGCTGGGGTGGGG - Intergenic
1139353364 16:66351749-66351771 CACGCTGGAGTGCAGTGGTGTGG - Intergenic
1139595121 16:67953051-67953073 CAGACTGGAGTGCCGTGGTGTGG - Intronic
1141238218 16:82240496-82240518 CAGACTGGAGTGCTGGTGAGAGG - Intergenic
1141439775 16:84022468-84022490 CAGGCAGCAGGGCTGGGGTGTGG + Intronic
1141608435 16:85168754-85168776 CTCACTGCAGCCCTGGGGTGGGG + Intergenic
1141621990 16:85241267-85241289 CACCCTAGAGGGCTGTGGTGAGG + Intergenic
1141667271 16:85472305-85472327 CCCTCTGGAGGCCTGGGGGGAGG + Intergenic
1141768145 16:86072194-86072216 CACAGTGGGAGGCTAGGGTGGGG - Intergenic
1141886952 16:86898833-86898855 CTCACTGCAGGGCTGGAGGGTGG - Intergenic
1141941012 16:87276274-87276296 CTCACTGGAGTGCTTGGGGGAGG - Intronic
1142210254 16:88805229-88805251 GACACAGCAGAGCTGGGGTGTGG + Intronic
1142221016 16:88855005-88855027 CAGGGTGGAGGGGTGGGGTGTGG - Intronic
1142349685 16:89574501-89574523 CAGCCTGGAAGGCTGGGCTGAGG + Intergenic
1203005153 16_KI270728v1_random:196775-196797 CACAGTGCAGGACTGTGGTGGGG - Intergenic
1203079712 16_KI270728v1_random:1140886-1140908 CCCCCTGGAGGGGTGGGGTGGGG + Intergenic
1203136703 16_KI270728v1_random:1732896-1732918 CACAGTGCAGGACTGTGGTGGGG - Intergenic
1203149828 16_KI270728v1_random:1827566-1827588 CACAGTGCAGGACTGTGGTGGGG + Intergenic
1142550438 17:735065-735087 CAGACTGGAGTGCAGTGGTGAGG + Intronic
1142808708 17:2385349-2385371 CACACTGATGGGCTGGGGCAGGG - Exonic
1143183662 17:4998441-4998463 GATACTGGGCGGCTGGGGTGGGG - Intronic
1143265232 17:5631715-5631737 CACTCTGTAGGGCTGTTGTGAGG + Intergenic
1143425622 17:6834675-6834697 AGAACTGGATGGCTGGGGTGTGG + Intergenic
1144825946 17:18105822-18105844 CACAGTGGAGGGCGGTGGGGAGG - Intronic
1145241296 17:21242259-21242281 CACCCAGGAAGGCTGGGTTGGGG + Exonic
1145768162 17:27473526-27473548 CAGCCTGTAGGGCTGGGGTTTGG + Intronic
1146517633 17:33501858-33501880 CATTGTGGAGGGCTGGGGTAAGG + Intronic
1146971325 17:37074720-37074742 CACATTGGGAGGCTGAGGTGGGG - Intergenic
1147112973 17:38277507-38277529 CATTCTGGGGGGTTGGGGTGGGG - Intergenic
1147369079 17:39979452-39979474 CACCCTCCAGGGCTGGGGGGTGG - Intergenic
1147793359 17:43026402-43026424 CACTTTGGGAGGCTGGGGTGGGG + Intronic
1148063801 17:44854228-44854250 GACCCTCGAGGACTGGGGTGGGG + Intronic
1148103679 17:45108049-45108071 CACACTGCAGGGCTCCTGTGGGG - Exonic
1148416649 17:47511720-47511742 CAGTCTGGGGGGTTGGGGTGGGG + Intergenic
1148600512 17:48890924-48890946 CACACTGTAGTGCGGTGGTGCGG - Intergenic
1148797538 17:50204210-50204232 CAGACTGGGGGGATGGGGGGTGG + Intergenic
1148875962 17:50687387-50687409 CGTTCTGGAGGGCTGGGCTGTGG + Intronic
1149614807 17:57988422-57988444 CCCGCGGGGGGGCTGGGGTGGGG + Intergenic
1149833275 17:59890286-59890308 CAGGCTGGAGGGCAGTGGTGCGG + Intronic
1149853544 17:60057250-60057272 CAATCAGGAGGGCTGAGGTGAGG + Exonic
1149967547 17:61180970-61180992 CACTTTGGGAGGCTGGGGTGGGG + Intronic
1150285331 17:63950802-63950824 CGCAGTGGAGGGGTGGGGAGGGG + Intronic
1150429751 17:65105635-65105657 AACAGTGGTGGGGTGGGGTGGGG + Intergenic
1151391603 17:73791038-73791060 ATCACTGGTGGGGTGGGGTGGGG + Intergenic
1151420205 17:73991954-73991976 CACTTTGGAAGGCTGAGGTGGGG + Intergenic
1151538099 17:74749796-74749818 CACACCGGCGGGCTGCGGAGAGG - Intronic
1151548369 17:74807109-74807131 GACACTGGCGGGGTGGGGTGGGG - Intronic
1151755291 17:76072243-76072265 CGAACTGGAGGGCTGGGGGCGGG - Intronic
1151896022 17:76981489-76981511 CACTTTGGGAGGCTGGGGTGGGG + Intergenic
1152595534 17:81236016-81236038 CCCACTCAGGGGCTGGGGTGGGG + Intronic
1152632616 17:81417327-81417349 CACTCTGGAGGGCTGTGGGGCGG - Intronic
1152987325 18:332662-332684 AACACTGTAGGGATGGAGTGGGG - Intronic
1153214475 18:2806770-2806792 CACTGTGGACTGCTGGGGTGAGG + Intergenic
1153585328 18:6614873-6614895 CACAATGGAGGAGTGGGGGGAGG + Intergenic
1154435959 18:14341681-14341703 CACACTGCAGAGCTGGAGTGGGG - Intergenic
1154999789 18:21674930-21674952 GGAACTGGAGGGATGGGGTGGGG + Intronic
1155203246 18:23535697-23535719 CACACTGGAGGGGAGAGGGGAGG + Exonic
1155932664 18:31723960-31723982 CAGCCTGGTGGGGTGGGGTGGGG - Intergenic
1156263302 18:35464358-35464380 CACCCTACAGGACTGGGGTGGGG + Intronic
1156583386 18:38405491-38405513 CCCAGTGGAGGGCTGGGGGTGGG - Intergenic
1157340319 18:46772190-46772212 GAACCTGGAGGACTGGGGTGGGG + Intergenic
1157643411 18:49242073-49242095 CACAGTGGAATGGTGGGGTGGGG - Intronic
1157764547 18:50286690-50286712 GACACTGGCAGGGTGGGGTGAGG - Intronic
1158390240 18:57039122-57039144 CAGTCTAGTGGGCTGGGGTGGGG + Intergenic
1158472262 18:57747406-57747428 CAGACTGGAGTGCAGTGGTGGGG - Intronic
1158719846 18:59915126-59915148 CAGGCAGGAAGGCTGGGGTGCGG + Intergenic
1158849663 18:61482740-61482762 CACTTTGGAAGGCTGGGTTGGGG - Intronic
1159201344 18:65188922-65188944 CAATCTGGAGGGCAGAGGTGAGG - Intergenic
1159403647 18:67971787-67971809 CCCACTTAAGGGCTGAGGTGAGG - Intergenic
1159923908 18:74250016-74250038 CACACTGAGGTGCTGGGGTTAGG - Intergenic
1160163953 18:76494846-76494868 CGCAGTGGAGGGGCGGGGTGGGG - Intronic
1160189790 18:76706546-76706568 CCCACTGGAGGGCGGGGGCAGGG - Intergenic
1160663207 19:311067-311089 TCCACTGAAGGGCTTGGGTGAGG - Intronic
1160724671 19:612772-612794 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1160805160 19:989432-989454 CACACAGGACGCCTGGGGTCAGG + Intronic
1160825917 19:1080558-1080580 CTCTCTGGCGGGCTGGGGTGTGG + Intronic
1160837767 19:1132677-1132699 CAGCCTGCAGGGGTGGGGTGGGG - Intronic
1160840737 19:1146066-1146088 CACGCTGGAGGCCGGGGCTGGGG - Intronic
1160875486 19:1294584-1294606 CACACAGGAAGGCAGGGGTGGGG + Intronic
1161349396 19:3783774-3783796 CCCACTGCAGGGACGGGGTGGGG + Intronic
1161385197 19:3988056-3988078 CACGCTGGAGTGCAGTGGTGCGG + Intergenic
1161520740 19:4722455-4722477 CAGCCAGGAAGGCTGGGGTGTGG - Intronic
1161702393 19:5802591-5802613 AATGATGGAGGGCTGGGGTGGGG + Intergenic
1161906282 19:7159148-7159170 CACACTGGGAGGCCGAGGTGGGG - Intronic
1162472628 19:10881601-10881623 TCCCCTGGAGGGCTGGGGTGGGG + Intronic
1162488394 19:10976346-10976368 CTCCCTGAAGGGCTGGGGTGAGG - Intronic
1162518094 19:11161960-11161982 CACATTGGGAGGCTGAGGTGGGG + Intergenic
1162968220 19:14165703-14165725 GAGACTGGAGGGGTGTGGTGAGG + Intronic
1163395891 19:17061097-17061119 CAGACTGGGAGCCTGGGGTGAGG + Intronic
1163466440 19:17470765-17470787 CACGGTGCAGGGCTGGGTTGCGG + Intronic
1163647025 19:18495341-18495363 CACCCTGGGCTGCTGGGGTGTGG + Intronic
1163752055 19:19083936-19083958 CACGCTGGGGTGGTGGGGTGCGG - Intronic
1164806819 19:31123450-31123472 TACACTGGAGGGCCGGGCTGGGG - Intergenic
1165066769 19:33234236-33234258 CTCACAGGAGGGATGGGTTGGGG - Intergenic
1165090166 19:33382790-33382812 CACACTGGACGGCTGGGGGTAGG + Intergenic
1165387168 19:35517342-35517364 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1165908801 19:39211067-39211089 CCCAGAGTAGGGCTGGGGTGGGG - Intergenic
1165945263 19:39437912-39437934 GACACTGGAGGGCAGGTCTGGGG + Intronic
1166738426 19:45099725-45099747 CACACAGGAGGGCTCGGGCACGG + Intronic
1166820363 19:45575649-45575671 CAGGCTGGAGTGCAGGGGTGCGG + Intronic
1166831450 19:45642038-45642060 CACACTGGAGGGATGGGGTTAGG + Exonic
1166831463 19:45642101-45642123 TAGACTGGAGGGGTGGGATGGGG - Intronic
1167086002 19:47310075-47310097 CACACTCCAGGGCTGGGATGTGG + Intronic
1167630792 19:50625344-50625366 CAGGCAGGAGGGCTGGGGTGGGG - Intronic
1167683164 19:50938337-50938359 CAGACTGGTGGGGTGGGGTGGGG - Intergenic
1167708159 19:51094078-51094100 CACAGGGGAGGCCTGAGGTGGGG - Intergenic
1167780058 19:51593292-51593314 TGGACTGGAGGGCTGGGCTGTGG - Intergenic
1168611421 19:57803865-57803887 CAAACCGCAGGGCTGGGGAGAGG + Intronic
1168702776 19:58451646-58451668 CACACCGGTGGTCTGGGCTGTGG + Exonic
1168705260 19:58467101-58467123 CACACCGGTGGTCTGGGCTGGGG + Exonic
1202689924 1_KI270712v1_random:79249-79271 CACAGTGCAGGGCTGTGGTGGGG + Intergenic
925081810 2:1075312-1075334 CACATTGCAGGGCTGAGCTGTGG + Intronic
925185538 2:1843834-1843856 CACCATGGAGGCCTGGGCTGGGG + Intronic
925278717 2:2668636-2668658 CGCACTGGAGGCCATGGGTGTGG - Intergenic
925666110 2:6258036-6258058 CCCGCAGGAGGGCAGGGGTGGGG - Intergenic
925795768 2:7540813-7540835 CACACTGTAGGGCTGTGGATGGG - Intergenic
926084109 2:10010269-10010291 CACACTGGAGAGCAGGCATGGGG + Intergenic
926592146 2:14751288-14751310 CACTGTGGGGGGCTGGGATGAGG - Intergenic
927473397 2:23393809-23393831 CACACAGGAGGTTTGGGGTGTGG + Intronic
927730224 2:25464587-25464609 CATACTCAAGGGCAGGGGTGAGG - Intronic
927957827 2:27220401-27220423 CACTTTGGAAGGCTGAGGTGGGG + Intronic
928975000 2:37077351-37077373 CACGCTGGAGTGCAGTGGTGTGG + Intronic
929399394 2:41562641-41562663 CAGGCTGGAGTGCTGGAGTGCGG + Intergenic
929451711 2:42042422-42042444 CTCACTGGAGAGAAGGGGTGAGG - Intergenic
929560979 2:42956297-42956319 CACACTGGAGTGCAGTGGCGTGG - Intergenic
930033075 2:47069981-47070003 AATACTTGAGGGCAGGGGTGGGG + Intronic
930124071 2:47782992-47783014 CACACTGGTGGGTAGGGGCGGGG - Intronic
931069921 2:58635021-58635043 AAGACTGGCGGGTTGGGGTGGGG - Intergenic
931339926 2:61390849-61390871 CACTCTGGGAGGCTGAGGTGGGG + Intronic
931645429 2:64417534-64417556 CAAACTGGGGGGCTAGGGTGGGG + Intergenic
931804454 2:65790482-65790504 GAGGCTGGAGGGCTGGGCTGGGG + Intergenic
932326125 2:70863013-70863035 CAGACTTGTTGGCTGGGGTGGGG - Intergenic
932630544 2:73339436-73339458 CACACTACAGGGCTGATGTGTGG + Intergenic
932881542 2:75506773-75506795 CCCAGTGAAGTGCTGGGGTGGGG + Intronic
933519617 2:83353312-83353334 CACACTGGGGGACTGTTGTGGGG + Intergenic
933900881 2:86849263-86849285 AAGGCTGGATGGCTGGGGTGTGG + Intronic
933956494 2:87376774-87376796 CACAGTGCAGGGCTGTGGTGGGG - Intergenic
934024163 2:87986178-87986200 CAGGCTGGAGTGCTGTGGTGCGG + Intergenic
934240640 2:90268800-90268822 CACAGTGCAGGGCTGTGGTGGGG - Intergenic
934247819 2:90323408-90323430 CACAGTGGCGGGGGGGGGTGGGG + Intergenic
934272552 2:91547959-91547981 CACAGTGCAGGGCTGTGGTGGGG + Intergenic
934558218 2:95298640-95298662 CACAAGGGAGGCCTGGGGTTTGG - Intronic
934567747 2:95349906-95349928 GACCCTGTAGGGCTGGGCTGGGG + Intronic
934743424 2:96742344-96742366 CAGGCTGGAGTGCTGTGGTGCGG - Intergenic
934851860 2:97706908-97706930 AGCACTGGGGGGCTGGGGGGAGG + Intergenic
935745022 2:106182809-106182831 TACACTGGTGGGTGGGGGTGGGG + Intronic
935779661 2:106499968-106499990 AAGGCTGGATGGCTGGGGTGTGG - Intergenic
936017575 2:108971351-108971373 GATACTGGAGGTCTCGGGTGCGG - Intronic
936093797 2:109516960-109516982 TACACTGGAGGACTGGGCTGGGG - Intergenic
936148600 2:109997871-109997893 CACAGTGCAGGGCTGTGGTGGGG + Intergenic
936196078 2:110373497-110373519 CACAGTGCAGGGCTGTGGTGGGG - Intergenic
936278479 2:111119750-111119772 CAGACAGGAGGGCCGGGGTTGGG + Intronic
936375939 2:111941647-111941669 CCCACTGGGAGGGTGGGGTGTGG - Intronic
936502443 2:113077032-113077054 AACAGTAGAAGGCTGGGGTGGGG + Intergenic
936522543 2:113220221-113220243 ATCAATGCAGGGCTGGGGTGTGG + Intronic
936623898 2:114127689-114127711 CAGGCTGGAGGGCAGTGGTGTGG + Intergenic
936823968 2:116557750-116557772 CACACTGGGGGCCTGTCGTGGGG + Intergenic
936930886 2:117787675-117787697 CCCAGTGTAGGTCTGGGGTGTGG + Intergenic
937862716 2:126723541-126723563 CACTCAGAAGGCCTGGGGTGTGG - Intergenic
937985826 2:127637679-127637701 CATTCTGGTGGGGTGGGGTGGGG - Exonic
938020383 2:127901487-127901509 CACAGGGCAGGACTGGGGTGGGG - Intergenic
938079474 2:128362003-128362025 CACCCAGGAGGGCTGGGATCTGG + Intergenic
938297796 2:130189225-130189247 CGCACTGAGGGGGTGGGGTGTGG + Intronic
938387007 2:130873762-130873784 CACTTTGGAGGGGTGGGGTTTGG + Intronic
938458971 2:131485443-131485465 CGCACTGAGGGGGTGGGGTGTGG - Intronic
938710276 2:133970712-133970734 TACCCAGGAGGTCTGGGGTGGGG - Intergenic
938814278 2:134883742-134883764 CACTCTGGGAGGCTGAGGTGGGG - Intronic
938902768 2:135812040-135812062 CCCGCTGGAGAGCTGGAGTGCGG - Intronic
940116988 2:150219967-150219989 CACACTGGGAGGACGGGGTGGGG - Intergenic
940223111 2:151374551-151374573 GTCACTGAAAGGCTGGGGTGTGG - Intronic
940553192 2:155187627-155187649 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
942073941 2:172339623-172339645 CACAGAGGAGGGCAGGAGTGAGG + Intergenic
942458493 2:176153296-176153318 CACCCTGGAGGGGTGGAGTGGGG - Intronic
942781597 2:179649431-179649453 CACCCTGGAGCGCTGTGGTATGG - Intronic
944757659 2:202780676-202780698 CAGACCAGAGGGCTGGGGTTTGG + Intronic
944805202 2:203274228-203274250 CAGACTGGAGTGCAGTGGTGCGG + Intronic
945247062 2:207728318-207728340 CAAGCTGGAGGGCAGTGGTGTGG + Intronic
945977199 2:216280196-216280218 CTCACAGGAGGGCTGGGAGGGGG + Intronic
946066590 2:216992789-216992811 GACACTGGAGTGCTGGGGCGTGG + Intergenic
946196513 2:218035526-218035548 CACAGTGGAGGGAAGGGGAGAGG - Intronic
946200792 2:218069690-218069712 CACAGTGGAGGGAAGGGGAGAGG - Intronic
946949534 2:224858411-224858433 CACTTTGGAAGGCTGAGGTGGGG + Intronic
947621207 2:231592443-231592465 CACTCTGGGAGGCTGAGGTGGGG - Intergenic
947712777 2:232325600-232325622 CACTCTGGAGGTCTGGGGTGGGG - Intronic
947732466 2:232439043-232439065 GACTCTGGAGGTCTGGGGTGGGG - Intergenic
948266391 2:236638155-236638177 TACACTGGAGAACTGGGGTCAGG - Intergenic
948506011 2:238427247-238427269 CACCCTGCAGGCCGGGGGTGGGG + Intronic
948656454 2:239479554-239479576 CACACTGGGAGGCTGTGCTGGGG + Intergenic
949050143 2:241893396-241893418 CACACGCGAGGTGTGGGGTGCGG + Intergenic
1169262884 20:4150331-4150353 CTCACTGGAGAGCTTGGCTGAGG - Intronic
1169372956 20:5042844-5042866 CACTCTGGAGTGCTGGAGTATGG + Intergenic
1169507094 20:6223000-6223022 CACAGTGAAGGGCAGGGATGAGG - Intergenic
1169759718 20:9078224-9078246 CACTTTGGAAGGCTGAGGTGGGG - Intronic
1170064687 20:12298799-12298821 AGCAGTGGAGGGCTGGGGTTTGG + Intergenic
1170648664 20:18219315-18219337 CACTTTGGAGGGCTGAAGTGGGG + Intergenic
1170653864 20:18268072-18268094 CTCCCTGGAGGTCAGGGGTGGGG - Intergenic
1171317351 20:24206751-24206773 GAAACTGGAGGGGTGGGGAGAGG - Intergenic
1171373263 20:24675177-24675199 CCCCCTTGAGGGCTGTGGTGGGG - Intergenic
1171449103 20:25223864-25223886 GACACTGCAGGGTTGGGTTGTGG + Intronic
1171770992 20:29323704-29323726 CACCCTGGAAGGGTGGAGTGTGG - Intergenic
1171905542 20:30895857-30895879 CACCCTGGAAGGGTGGTGTGTGG + Intergenic
1171959862 20:31485780-31485802 CCCGTTGGAAGGCTGGGGTGCGG - Intergenic
1172264747 20:33601307-33601329 CAGACTGGAGTGCAGTGGTGCGG + Intronic
1172279036 20:33697875-33697897 CAGGCTGGAGTGCAGGGGTGTGG + Intergenic
1172319898 20:33988182-33988204 CAAGCTGGAGTGCTGTGGTGCGG - Intergenic
1172484478 20:35290183-35290205 CTCAGTTGAGGGCTGGGCTGGGG + Intronic
1172699913 20:36846668-36846690 GACGCTGGAGGGCTGGGGTAAGG - Intronic
1172766578 20:37354370-37354392 CACCCGGTGGGGCTGGGGTGGGG + Intronic
1172848905 20:37946464-37946486 CACAGGGGAGGGCAGGGGAGGGG - Intergenic
1172940430 20:38650174-38650196 CTCTCTGGAGGGCTGGAGGGTGG - Exonic
1173226092 20:41163193-41163215 CTCCCTGCAGGGCTGGGGAGCGG + Exonic
1173336785 20:42118587-42118609 CACACTGGTGAGCAGGAGTGAGG + Intronic
1173691910 20:44967035-44967057 CCCACTTGAGGGGTGCGGTGGGG + Intronic
1174018878 20:47512910-47512932 CACTTTGGAAGGCTGAGGTGGGG + Intronic
1174171480 20:48620484-48620506 TTCCCTGGAGGGCTGGAGTGGGG - Intergenic
1174172791 20:48627672-48627694 CACACTGGGGGGTGGGGGTGGGG + Intronic
1174380484 20:50152849-50152871 ACCACTGGAGGGTTGGGGAGAGG + Intronic
1174384020 20:50176077-50176099 CACCCTCTAGGGCTGGTGTGAGG - Intergenic
1174843274 20:53919509-53919531 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1175033293 20:55975849-55975871 CACTTTGGGAGGCTGGGGTGTGG - Intergenic
1175067610 20:56303026-56303048 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1175416417 20:58804314-58804336 CACACTGGAGGGAGTGGGTGTGG - Intergenic
1175497400 20:59424140-59424162 CCCAGTGGAGGGTTGGGGAGGGG + Intergenic
1175542597 20:59757144-59757166 CACACACAAGGGCTGGGCTGTGG - Intronic
1175639990 20:60620888-60620910 CACACAGGCTGGCAGGGGTGGGG + Intergenic
1175852123 20:62099286-62099308 CCCACGGAAGGGCTGGGTTGAGG - Intergenic
1175976088 20:62711130-62711152 CACCCAGGTGGGCTGGGGGGTGG + Intronic
1176114017 20:63423268-63423290 GACACTGCGGGGCTTGGGTGCGG - Intronic
1176173334 20:63706310-63706332 GGCACTGGAGGGCTGGGGTGGGG + Intronic
1176209547 20:63911921-63911943 CACTTTGGAAGGCTGAGGTGGGG - Intronic
1176247257 20:64103273-64103295 CAGGCTGGAGTGCTGTGGTGGGG - Intergenic
1176309283 21:5141249-5141271 CACCCTGAGGGGCTGGGCTGGGG - Intronic
1176411978 21:6454084-6454106 CACGCTGACGGGCTGTGGTGGGG - Intergenic
1176841075 21:13843954-13843976 CGCACTGCAGAGCTGGAGTGGGG + Intergenic
1176988424 21:15464771-15464793 CACACTGGGGGCCTGTTGTGGGG + Intergenic
1177031462 21:15985080-15985102 TTCTCTGGAGGGCAGGGGTGGGG + Intergenic
1177546303 21:22562784-22562806 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1179044981 21:37835825-37835847 CACACTGGAGGGTTAGGGTTAGG - Intronic
1179597468 21:42452446-42452468 ACAACTGGTGGGCTGGGGTGAGG - Intergenic
1179598117 21:42456836-42456858 CACACTTGAGGGCTGAGGTGAGG - Intergenic
1179687472 21:43062406-43062428 CACGCTGACGGGCTGTGGTGGGG - Intronic
1179805790 21:43836063-43836085 CATCCTGTGGGGCTGGGGTGAGG - Intergenic
1179847779 21:44120784-44120806 CACCCTGAGGGGCTGGGCTGGGG + Intronic
1179958955 21:44757711-44757733 CACAGTAGAGAGCTGGGGGGTGG + Intergenic
1180071389 21:45438401-45438423 CACACTCCAGGGCTGGGCAGGGG + Intronic
1180075555 21:45459715-45459737 CACACGGGAGGGCCGGGGTGGGG + Intronic
1180338954 22:11601972-11601994 CACCCTGGAAGGGTGGAGTGTGG + Intergenic
1180551491 22:16545313-16545335 CACGGTGCAGGGCTGTGGTGGGG - Intergenic
1180856206 22:19047299-19047321 CACACTGGGGGGCTGCTGGGTGG - Intronic
1180996428 22:19968080-19968102 GACCCTGCAGGGCTGAGGTGGGG - Intronic
1180997888 22:19974476-19974498 CATCCAGGAGGCCTGGGGTGGGG + Intronic
1181041781 22:20195715-20195737 CACTCTGGAAGGCTGAGATGTGG + Intergenic
1181114205 22:20621091-20621113 CAGACTGGAGGGTGGGGGTGAGG - Intergenic
1181352510 22:22268610-22268632 CACAGTGCAGGGCTGTGGTGGGG + Intergenic
1181542617 22:23581499-23581521 CACACTCCAGGGCTGGGTTGAGG + Intergenic
1182483759 22:30626924-30626946 CAGAGTGGAGAGCTGGGGTCAGG - Exonic
1182548434 22:31088796-31088818 CAGACAGCAGGGCAGGGGTGGGG - Intronic
1182583501 22:31329140-31329162 CACTCTGCAAGGCTGCGGTGAGG + Intronic
1183285809 22:36962907-36962929 CACACTGGATTCCTGGGTTGGGG + Intergenic
1183296068 22:37030271-37030293 CACACTTGGGGGCTGGTCTGTGG + Intergenic
1183318213 22:37148498-37148520 CACCTTGCAGGGCTGTGGTGGGG - Intronic
1183365810 22:37406348-37406370 CACAACGGAGTGCCGGGGTGTGG + Intronic
1183406165 22:37631697-37631719 CTGCCTGGAGTGCTGGGGTGAGG - Intronic
1183460939 22:37950155-37950177 CACACTGGAGTGCAGTGGTATGG + Intronic
1183601831 22:38844286-38844308 AGCACGGGAGGGCTGGGATGGGG - Intergenic
1183622360 22:38982004-38982026 CACACATTAGGGCTGGGGAGGGG + Intronic
1183627523 22:39013903-39013925 CACACATTAGGGCTGGGGAGGGG + Intergenic
1184330912 22:43826903-43826925 CACAAGGGAGGGCTGAGCTGTGG + Intronic
1184344241 22:43903264-43903286 CAGACTGGAGTGCAGGGGTGTGG + Intergenic
1184508155 22:44916669-44916691 CACACAGGAGTGCAGGGGAGGGG + Intronic
1185062480 22:48614210-48614232 CACAATGAAGAGTTGGGGTGAGG - Intronic
1185198265 22:49486173-49486195 CTCACTGGGGGGCTGGACTGGGG + Intronic
1185274274 22:49943659-49943681 CACCCTGGAGGGCTGGTGTGGGG - Intergenic
949160207 3:872903-872925 TTCCCTGGAGGGTTGGGGTGGGG + Intergenic
950378521 3:12591660-12591682 CCCTCTGGAGTGCTGGAGTGGGG - Intronic
950459194 3:13111200-13111222 CACACTGGGGAGGTGGGCTGAGG - Intergenic
950634778 3:14307219-14307241 CTCTGTGCAGGGCTGGGGTGGGG + Intergenic
950813550 3:15673928-15673950 CACTCTGGGAGGCTGAGGTGGGG + Intronic
951995272 3:28720785-28720807 GATAGTGGAGGGATGGGGTGAGG + Intergenic
952287478 3:31981956-31981978 CACACGGCTGGGCTGGGGTGAGG + Intronic
953610431 3:44443180-44443202 CACTCTGGGGGGCTGGCATGGGG + Exonic
953742787 3:45551749-45551771 GGCACTGGAGGCCTGGAGTGAGG - Intergenic
953878267 3:46678673-46678695 ACCACTGAGGGGCTGGGGTGGGG + Intronic
953915210 3:46914859-46914881 CACGCTGGAGTGCAGTGGTGCGG - Intergenic
953969076 3:47333087-47333109 GAGATTGGAGGCCTGGGGTGTGG + Intronic
954082680 3:48221795-48221817 CAGTGTGCAGGGCTGGGGTGAGG + Intergenic
954400415 3:50316776-50316798 AACAGTTCAGGGCTGGGGTGTGG - Intergenic
955194023 3:56788190-56788212 CACACTTGAGGACTGGGGGGTGG + Intronic
955412035 3:58661982-58662004 GACACTGGAGGGCAGGGAAGGGG - Intronic
956424747 3:69122235-69122257 CCCACGGGAAGGCTGGGGTCAGG + Exonic
957235453 3:77583103-77583125 CAGACTGGAGTGCTGGAGTGTGG - Intronic
957371417 3:79300133-79300155 CACACTGCAGCGGTGGGCTGAGG - Intronic
957446074 3:80314416-80314438 CACAGTGCAGGGGTGGGCTGAGG - Intergenic
957955143 3:87176825-87176847 AAGACTGGATGGCTGGGATGAGG + Intergenic
959161411 3:102729434-102729456 CACAATGCAGGGGTGGGGAGTGG - Intergenic
959720952 3:109488425-109488447 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
960622942 3:119653960-119653982 CACACAGGAGTGCTAGGCTGTGG + Intronic
960997283 3:123348535-123348557 GAGACTGGAAGGATGGGGTGGGG + Intronic
961377198 3:126475214-126475236 CCCACTGGAGGGCTGTGGTTGGG - Exonic
961582298 3:127892695-127892717 CCCACTGGGGGTCTCGGGTGGGG - Intergenic
962133086 3:132703622-132703644 CAGGCTGGAGGGCAGGGGTGTGG + Intronic
962604073 3:137017348-137017370 CACACTGGGGGCCTGTTGTGGGG - Intergenic
962610265 3:137069994-137070016 CACACTGGGGGCCTGTTGTGGGG - Intergenic
963115907 3:141728789-141728811 TACCCTGGAGGGCAGGGGAGTGG + Intergenic
963721630 3:148868136-148868158 CACTTTGGAAGGCTGAGGTGCGG - Intronic
963899631 3:150721755-150721777 CTCTCAGGAGAGCTGGGGTGTGG - Intergenic
964629839 3:158798532-158798554 CACTCTGGGAGGCTGAGGTGGGG - Intronic
965576444 3:170222628-170222650 AACGCTGGAGGCCGGGGGTGCGG - Exonic
966832008 3:184017790-184017812 CGAGCTGGAGGGCAGGGGTGCGG + Intronic
966939255 3:184735105-184735127 GACACCGGAGGGCAGGGTTGGGG - Intergenic
967139991 3:186549241-186549263 CAAACTGGAGTGCAGTGGTGCGG - Intronic
967180237 3:186896965-186896987 CACACTGGAGGGCTGTGCTCTGG + Intergenic
967388109 3:188929854-188929876 CACTGTGGATGGCGGGGGTGCGG - Intergenic
967739626 3:192990748-192990770 GACACTGCAGGGCTGTGGGGAGG + Intergenic
968168087 3:196484899-196484921 CACTTTGGAAGGCTGTGGTGGGG - Intronic
968612491 4:1563583-1563605 CACTTTGGAGAGCTGGCGTGGGG + Intergenic
968661648 4:1801146-1801168 CACCCTGGAGGGGAGGGGAGGGG + Intronic
968736613 4:2300558-2300580 CCCACTGGAGTCCTGGCGTGAGG - Intronic
968922361 4:3528901-3528923 GACGCTTGAGAGCTGGGGTGGGG + Intronic
968959911 4:3738181-3738203 CACAGTGGAGGGGTGGACTGTGG + Intergenic
969036502 4:4258058-4258080 CCTACTGGAGGGCAGCGGTGGGG + Intergenic
969216443 4:5726375-5726397 CAAAGTGCAGGGCTGGGGTGAGG + Intronic
969228580 4:5814701-5814723 CCCAGTGGGGGGCAGGGGTGTGG - Intronic
969498494 4:7539744-7539766 CTCACAGCAGGGATGGGGTGGGG - Intronic
969642737 4:8408886-8408908 CTCACTGGGGGGGGGGGGTGGGG + Intronic
969666958 4:8564062-8564084 CAGGCTGGAGGGCAGTGGTGTGG - Intronic
969868903 4:10092852-10092874 CCCGCTGGTTGGCTGGGGTGGGG - Intronic
969922224 4:10551287-10551309 CACGCTGGAGTGCAGTGGTGTGG + Intronic
970276128 4:14403168-14403190 CAAAGGGGAGGGTTGGGGTGAGG + Intergenic
971539999 4:27804084-27804106 TAAACTGGTTGGCTGGGGTGGGG - Intergenic
972602812 4:40587597-40587619 CACATTGGAGGAATGGGGTGGGG + Intronic
973071958 4:45871596-45871618 CAGGCTGGAGTGCTGTGGTGTGG - Intergenic
973106998 4:46352278-46352300 CAAACAGGAGAGCTTGGGTGAGG - Intronic
973265945 4:48210438-48210460 CAGACTGGAGTGCAGTGGTGTGG - Intronic
974080555 4:57207972-57207994 CCCACTGGAAGGCTTGGGGGAGG + Intergenic
974621504 4:64361553-64361575 AACACTGGAGGGCTGGGCCCAGG - Intronic
974648951 4:64729708-64729730 TTCTCTGGTGGGCTGGGGTGGGG - Intergenic
975588268 4:75972974-75972996 CAGGCTGGAGGGCAGTGGTGTGG - Intronic
976547589 4:86355383-86355405 TACACTGGGGTGTTGGGGTGAGG - Intronic
977057776 4:92215039-92215061 CACACTGGGGGGCTGTCATGGGG + Intergenic
977097737 4:92767704-92767726 CAGACTGGAGTGCAGTGGTGTGG - Intronic
977361747 4:96014338-96014360 CACTTTGGAAGGCTGAGGTGGGG + Intergenic
977495759 4:97773555-97773577 CACTTTGGAAGGCTGAGGTGGGG - Intronic
978124694 4:105121790-105121812 CAGGCTGAAGGGCTGTGGTGTGG - Intergenic
978328510 4:107586482-107586504 CACACTGGGAGGATGGGGTAGGG - Intergenic
978942143 4:114448836-114448858 AACACTGGGGGGCTGGGACGAGG - Intergenic
978973810 4:114843982-114844004 TATACAGGAGGGTTGGGGTGGGG - Intronic
979107674 4:116708010-116708032 CACTTTGGAAGGCTGAGGTGGGG - Intergenic
979250730 4:118564376-118564398 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
979719304 4:123880587-123880609 AGCACTGCAGGGGTGGGGTGGGG + Intergenic
980103654 4:128566410-128566432 GGCAGTGGATGGCTGGGGTGAGG + Intergenic
981108674 4:140910802-140910824 CAGACTGGAGGGCAGGTGAGGGG - Intronic
981405255 4:144360337-144360359 CAGGCTGTAGGGCTGGGATGAGG - Intergenic
981630545 4:146813937-146813959 CAAACTGGAGTGCAGTGGTGTGG - Intronic
982179454 4:152736111-152736133 CACTTTGGAAGGCTGAGGTGGGG + Intronic
982624937 4:157754983-157755005 CACACTGGAGGGCCTGTGGGAGG - Intergenic
983019339 4:162655910-162655932 AACAGAGGAGGGCTGGGGAGTGG - Intergenic
983186612 4:164707703-164707725 CACACCAGTGGGGTGGGGTGGGG - Intergenic
983938829 4:173521704-173521726 CTCCCTGGAGGGCTGGGGGAAGG + Intergenic
984074493 4:175157851-175157873 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
984158339 4:176221341-176221363 CACAAGGGAAGCCTGGGGTGAGG - Intronic
984758748 4:183346426-183346448 CACTTTGGGAGGCTGGGGTGGGG - Intergenic
985472688 5:55246-55268 CACACTGGGGGCCTGGAGTCGGG + Intergenic
985723264 5:1501700-1501722 CAGAGTGGAGAGCTGGGGAGGGG + Intronic
986088158 5:4474060-4474082 CACACTGGAGGGGTTGGGGAGGG + Intergenic
986269911 5:6221173-6221195 CAAACAGCAGGGCTGGGGGGTGG - Intergenic
986463665 5:7998680-7998702 CACAGGGGTGGGTTGGGGTGGGG + Intergenic
986989093 5:13531098-13531120 AACACTGGAGGGGTGGGGGAAGG - Intergenic
987706632 5:21467948-21467970 CACTCTGGGGGACTGTGGTGGGG + Intergenic
989278912 5:39619830-39619852 CAGGCTGGAGTGCTGGAGTGTGG + Intergenic
989598253 5:43177990-43178012 CTCCCTGGAGGTCTCGGGTGGGG + Intronic
989622765 5:43401036-43401058 CACACTGGAGTGCAGTGGCGTGG - Intronic
990375250 5:55163549-55163571 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
990414815 5:55575859-55575881 CAGACTGGAGGGCAGCGGCGTGG + Intergenic
990782873 5:59385923-59385945 CACCCTGCAGGGATGAGGTGTGG - Intronic
991085994 5:62648683-62648705 CACACTGATGGGCAAGGGTGAGG + Intergenic
992373402 5:76168363-76168385 CATCCTGGTGGGCAGGGGTGGGG - Intronic
993709191 5:91206695-91206717 GACAGGGGAGGGCTGGGATGGGG - Intergenic
995752048 5:115462297-115462319 TACAATGAAGGGTTGGGGTGAGG + Intergenic
995786172 5:115830760-115830782 CACTTTGGAAGGCTGAGGTGTGG - Exonic
996440694 5:123486964-123486986 CACACTGGAGGTGGGGAGTGTGG - Intergenic
997322691 5:132991746-132991768 CACACTGGAGTGCAATGGTGCGG + Intergenic
997568486 5:134907287-134907309 CAGACTGGAGTGCAGTGGTGCGG + Intronic
997913373 5:137898766-137898788 CAGGCTGGAGTGCTGGAGTGCGG + Intronic
997929835 5:138063082-138063104 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
998097027 5:139401813-139401835 GACACTGGAGAGCCTGGGTGGGG + Exonic
998807702 5:145935120-145935142 CACTTTGGAAGGCTGAGGTGTGG - Intergenic
999247083 5:150160769-150160791 CACACAGCAGGCCTAGGGTGGGG + Intergenic
999254966 5:150205023-150205045 CGCAGTGGAGGGCTGTGGGGTGG + Intronic
999928352 5:156404078-156404100 CACTCTGGGAGGCTGAGGTGAGG - Intronic
1000134755 5:158336731-158336753 CAATGTGGGGGGCTGGGGTGGGG + Intergenic
1000519772 5:162280928-162280950 TTCTCTGGAGGGCTGGAGTGGGG + Intergenic
1001266503 5:170278309-170278331 CAGAGTGGGGGGCTGGGGAGGGG + Intronic
1001803195 5:174560987-174561009 TGCACTGGAATGCTGGGGTGAGG - Intergenic
1002119069 5:176987604-176987626 CAGGCTGGAGGGCAGTGGTGTGG - Intronic
1002270804 5:178070770-178070792 GCCAGTGGAGGCCTGGGGTGAGG - Intergenic
1002389706 5:178900382-178900404 GACACTGGCTGGCTGGGGTGGGG - Intronic
1002389718 5:178900429-178900451 GACACTGGCTGGCTGGGGTGGGG - Intronic
1002389741 5:178900523-178900545 GACACTGGCTGGCTGGGGTGGGG - Intronic
1002389764 5:178900617-178900639 GACACTGTCTGGCTGGGGTGGGG - Intronic
1002389777 5:178900664-178900686 GACACTGTCTGGCTGGGGTGGGG - Intronic
1002389788 5:178900711-178900733 GACACTGTCTGGCTGGGGTGGGG - Intronic
1002389809 5:178900805-178900827 GACACTGTCTGGCTGGGGTGGGG - Intronic
1003249462 6:4413274-4413296 GACTCAGGAGGTCTGGGGTGAGG - Intergenic
1003353686 6:5344831-5344853 CAGACTGGAGTGCAGTGGTGTGG + Intronic
1003429045 6:6022293-6022315 CACCATGGAGGGCTGGGGTGGGG + Intergenic
1003774653 6:9346896-9346918 CACCATGGAGGGTGGGGGTGGGG + Intergenic
1004745022 6:18501238-18501260 CACACTGGGGGACTGGGTTTGGG + Intergenic
1005044310 6:21627523-21627545 CAGACTGGAGTGCAGGGGTGCGG - Intergenic
1005379094 6:25215817-25215839 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1005650575 6:27881404-27881426 CAGGCTGGAGGGCAGTGGTGTGG + Intergenic
1005790603 6:29295984-29296006 CACACCGGTGGACTGGAGTGGGG + Intergenic
1005958867 6:30682727-30682749 CAAACAGGAAGCCTGGGGTGGGG - Intronic
1006144569 6:31950808-31950830 AAGGCTGGAGGACTGGGGTGAGG + Intronic
1006442276 6:34060040-34060062 CAGACTCCAGGGCTGGGGGGTGG + Intronic
1006454150 6:34122457-34122479 CTCACTCGAGGCCTGGGCTGGGG - Intronic
1006486976 6:34351102-34351124 CACTCTGGGAGGCTGAGGTGGGG + Intronic
1006905857 6:37533036-37533058 GACACTGGAGTGATGGGGTAGGG + Intergenic
1007103743 6:39269028-39269050 AAGAATGGAGGGGTGGGGTGGGG + Intergenic
1007192061 6:40027823-40027845 CACACTGGAGGGATGGAGAGAGG - Intergenic
1007866713 6:44978745-44978767 CACATGGGAGGACTAGGGTGAGG + Intronic
1007964970 6:45995958-45995980 GACTGTTGAGGGCTGGGGTGGGG + Intronic
1008410115 6:51167662-51167684 CTGACTGGTGGGGTGGGGTGTGG + Intergenic
1010116442 6:72317058-72317080 CTCAGAGGAGGGCAGGGGTGGGG + Intronic
1010215113 6:73394611-73394633 CACAGTGGGGGGGTGGGGGGCGG + Intronic
1010569482 6:77461139-77461161 CACAATTGAGGAATGGGGTGGGG - Intergenic
1011380472 6:86737450-86737472 CACACTGGGGGACTGTTGTGTGG + Intergenic
1011497674 6:87952546-87952568 CAGTCTGGAGTGCTGTGGTGTGG + Intergenic
1011935896 6:92776759-92776781 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1013347873 6:109279512-109279534 CAGAATAGAGGGCTGGGGTCAGG - Intergenic
1013388981 6:109664467-109664489 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1013810110 6:114035187-114035209 CATAATGGAGGGATGGAGTGAGG + Intergenic
1014451327 6:121585308-121585330 CACAGTGGAGAACTGGGCTGAGG + Intergenic
1015040109 6:128706206-128706228 CAGGCTGGAGGGCAGTGGTGCGG - Intergenic
1016913831 6:149226154-149226176 CACCCTGGATGGCTAGGGAGCGG - Intronic
1016972663 6:149779036-149779058 CAGAGTGGGGGGGTGGGGTGGGG - Intronic
1017342548 6:153342323-153342345 CACGCTGGAGTGCAGTGGTGTGG - Intergenic
1017434564 6:154404084-154404106 CACACTAGGAGGGTGGGGTGTGG - Exonic
1017717466 6:157222735-157222757 CACCCAGGAGGGCTGGGAGGAGG - Intergenic
1019324809 7:432875-432897 CCCACTGGGGGCCTAGGGTGGGG - Intergenic
1019383998 7:743328-743350 CAGGCTGGAGTGCAGGGGTGTGG - Intronic
1019499320 7:1356550-1356572 CACGCTGGAGTGCAGTGGTGTGG + Intergenic
1019523747 7:1471698-1471720 CCCTCTGGGTGGCTGGGGTGGGG - Intronic
1019578506 7:1749028-1749050 ATCAATGGAGGGGTGGGGTGGGG - Intergenic
1019601222 7:1884753-1884775 CAGACAGGAGGCCTGGGCTGGGG - Intronic
1019609760 7:1930532-1930554 CACGGTGGTGGGATGGGGTGAGG - Intronic
1019666133 7:2253047-2253069 AAGGCTGGAGGGCAGGGGTGAGG - Exonic
1019671784 7:2283764-2283786 CCAACAGGAGGGCTGGGGTGGGG + Intronic
1019796029 7:3049383-3049405 CACAGTGGAGGGTTGGGGGAGGG - Intergenic
1020091449 7:5344526-5344548 GACACTGGAGGTCAGGGGTGGGG + Intronic
1020439620 7:8203559-8203581 GATTCTGGAGGCCTGGGGTGGGG - Intronic
1020483958 7:8697507-8697529 CAGACTGAAGTGCTGGGGTAAGG + Intronic
1021905205 7:25326550-25326572 CCCAGTGGAGGGCTGGGGACGGG + Intergenic
1021920650 7:25481632-25481654 AACACTGGGAGGCTGAGGTGGGG - Intergenic
1022388833 7:29926337-29926359 CACACTGGATGGGTGGGGGTAGG + Intronic
1022933548 7:35148185-35148207 CATACTGCGGGGCTGGGCTGTGG - Intergenic
1023043310 7:36191378-36191400 CACACTGGAGAGGTGGGAAGAGG + Intronic
1023277324 7:38533881-38533903 CACACGTAAGGGCTGGGGAGGGG - Intronic
1023632298 7:42176773-42176795 CACTGAGGAGGGCTGGGCTGTGG - Intronic
1023881498 7:44324016-44324038 CATGCTGGATGGGTGGGGTGGGG - Intronic
1024204546 7:47145737-47145759 AACACAGGAGGGGTGGGGAGTGG + Intergenic
1024326626 7:48114289-48114311 CACACTGGAGGGAAGCCGTGGGG - Intergenic
1024480078 7:49853463-49853485 GACACTGGAGGGCAGAGATGGGG - Intronic
1025078613 7:55964215-55964237 GACATTGGCGGGGTGGGGTGGGG + Intronic
1025113033 7:56235486-56235508 CTCAGTTGAGGGGTGGGGTGTGG - Intergenic
1025297276 7:57785772-57785794 CACACTGGGGAGCTGAGGTAGGG + Intergenic
1025557663 7:62329249-62329271 CACACTCGGGGACTGTGGTGGGG - Intergenic
1026040109 7:66861214-66861236 AACACAGGAGGGCAGAGGTGGGG - Intergenic
1026899157 7:74027646-74027668 GAGTCTGGAGGGCCGGGGTGGGG + Intergenic
1027836206 7:83246552-83246574 CACACTGTGGGGCTGAGGTTGGG + Intergenic
1027868839 7:83680426-83680448 CAGGCTGGAAGGCTGGAGTGTGG + Intergenic
1028896601 7:96048487-96048509 GACACAGAAGGTCTGGGGTGGGG - Intronic
1028983824 7:96994584-96994606 CATTTTGGAGGGCTGGGGTGGGG - Intergenic
1029158529 7:98534568-98534590 CACTTTGGAGGACTGAGGTGAGG - Intergenic
1029452679 7:100649989-100650011 CTGGGTGGAGGGCTGGGGTGGGG - Intronic
1029625988 7:101720537-101720559 CACACTGGAGTGTTGGTGAGGGG - Intergenic
1029669104 7:102016565-102016587 CAGGCTGGAGTGCAGGGGTGTGG - Intronic
1029829479 7:103240956-103240978 CATACTGCAGGGCTGGGCTGTGG - Intergenic
1030654192 7:112148262-112148284 CACTCTGGAGAGCTGAGATGTGG - Intronic
1031061203 7:117053568-117053590 CACAGTGGAGGGCTGGGATGAGG - Intronic
1031598299 7:123672762-123672784 CACACTGGAGGAGTGGTGAGAGG - Intergenic
1032210654 7:129911038-129911060 CGCAATGGAGGGCAGGGTTGGGG + Intronic
1032409530 7:131684235-131684257 CAGACTGGAGTGCTGTGATGTGG + Intergenic
1032543312 7:132722231-132722253 GCCACTGGAGGCCTGGGGTGAGG + Intronic
1032580086 7:133096297-133096319 CACACTGGGAGGATGGGGTGAGG - Intergenic
1033337023 7:140462579-140462601 CACTCTGGGAGGCTGAGGTGTGG + Intronic
1034539044 7:151744418-151744440 CCCACTGCAGTGGTGGGGTGGGG - Intronic
1034725794 7:153333840-153333862 CACACTGTAGGGCTCTGATGAGG + Intergenic
1034842592 7:154413043-154413065 CCCTCAGGAGGGCTGGGATGGGG - Intronic
1035131380 7:156657207-156657229 CAAACTGGAGGGGTGAGGAGGGG - Intronic
1035372323 7:158387344-158387366 ACCACAGGAGGGCTGAGGTGGGG + Intronic
1036150198 8:6289923-6289945 CACACAGGAGGGTGGTGGTGGGG - Intergenic
1036415775 8:8546511-8546533 CAGGCTGGAGTGCAGGGGTGTGG - Intergenic
1036974387 8:13394699-13394721 AAGACTGGAGAGTTGGGGTGCGG - Intronic
1037324475 8:17674542-17674564 GAAACTGGAGGGCTGGGTGGTGG + Intronic
1037813786 8:22101623-22101645 CACGCAGGAGGGATGGGCTGGGG - Intronic
1037902271 8:22694995-22695017 CTCAGTGGAGGGCTGGGGACCGG + Intergenic
1037948672 8:23004916-23004938 AGCACTGGAGGGCTGGGGCTTGG + Intronic
1038563254 8:28598459-28598481 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1038635447 8:29282971-29282993 CATACTTGATGGGTGGGGTGTGG - Intergenic
1039098835 8:33918731-33918753 CAGGCTGGAGTGCTGTGGTGTGG + Intergenic
1039195485 8:35026432-35026454 CACTTTGGGAGGCTGGGGTGGGG + Intergenic
1039433873 8:37546312-37546334 CAAACTGGACAGGTGGGGTGAGG - Intergenic
1039495364 8:37976172-37976194 CAGACTGGAGTGCAGTGGTGAGG + Intergenic
1040543082 8:48376959-48376981 CAGGTTGGAGGGCTGGGGTCGGG - Intergenic
1041278766 8:56190517-56190539 CAGAATGGAGGCCTGGGGTGAGG + Intronic
1041641426 8:60206998-60207020 CACCTTGGTGGGCTGGGGTGGGG - Intronic
1042230593 8:66550521-66550543 CCCACTGGAGAGCAGTGGTGTGG + Intergenic
1042621909 8:70716415-70716437 CATTCTGCAGGGCTGCGGTGGGG + Intronic
1042943011 8:74126463-74126485 CACACAGGAGGGTGGGGTTGTGG - Intergenic
1043018488 8:74970469-74970491 CACTTTGGGGGGCTGAGGTGGGG - Intergenic
1043067063 8:75587456-75587478 CAGGCTGGAGTGCTGTGGTGCGG + Intergenic
1043209843 8:77498426-77498448 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1043455481 8:80408021-80408043 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1043874061 8:85464551-85464573 GAAGCTGGAGGGGTGGGGTGGGG - Intronic
1044479564 8:92669437-92669459 CAGGCTGGAAGGCTGGAGTGCGG + Intergenic
1044569448 8:93700707-93700729 CACACTGGAGGGCTGGGGTGAGG + Intronic
1044954533 8:97465683-97465705 CCCACTGGAGGTCTGGAGAGGGG + Intergenic
1045109550 8:98927211-98927233 CATACTGGAGGGCAGAGCTGAGG + Intronic
1045517131 8:102869784-102869806 CACTTTGGAAGGCTGAGGTGGGG + Intronic
1045943947 8:107773551-107773573 CACACTGCATGCCTTGGGTGAGG + Intergenic
1046161577 8:110373948-110373970 CACACTGGGGGCCTGTTGTGGGG - Intergenic
1046707827 8:117475976-117475998 CACACTGGAGGCCTTGGAAGGGG - Intergenic
1047293297 8:123549237-123549259 CACACTGGAGTGCAGTGATGCGG + Intergenic
1047510457 8:125511767-125511789 CACACTGGGCTGGTGGGGTGTGG + Intergenic
1048848887 8:138625362-138625384 CACAGTGGAGGGCAGGGTTGGGG + Intronic
1049025623 8:139986645-139986667 CACACTGGAGGGTTTGGGGTCGG - Intronic
1049289809 8:141795820-141795842 AACCCTGCAGGCCTGGGGTGGGG + Intergenic
1049433314 8:142575193-142575215 CTCCCTGAAGGGCTGGTGTGGGG - Intergenic
1049495958 8:142933484-142933506 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1049564355 8:143330549-143330571 CCCACGGGAGGGCTGGTGGGAGG + Intronic
1049623456 8:143609616-143609638 CCTATTGGAGGGCGGGGGTGGGG - Intronic
1049640467 8:143712871-143712893 GGCAGTGGGGGGCTGGGGTGTGG + Intronic
1049725020 8:144141871-144141893 CCCACGGGAGGGCTGGGGAGGGG - Intergenic
1049731264 8:144179732-144179754 CACCCTGCAGGGGTGGGGGGTGG + Intronic
1049742343 8:144247211-144247233 CCCAGAGGAGGGCTGGAGTGTGG - Intronic
1049745585 8:144261874-144261896 CTCACTGAAGGGCTTGGGTTTGG - Exonic
1049761270 8:144332954-144332976 CACCCTGGAGGGGAGGGGAGGGG + Exonic
1049809062 8:144555168-144555190 CACAGTGGAGGGGTGGGCTTTGG - Intronic
1050633291 9:7582963-7582985 CAGGCTGGAGTGCAGGGGTGCGG + Intergenic
1051295061 9:15586850-15586872 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1051356766 9:16246660-16246682 GACTTTGGAGGGATGGGGTGAGG - Intronic
1051424403 9:16919020-16919042 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1051565559 9:18494067-18494089 CACACAGGATGGCTGGGTGGTGG + Intronic
1051603255 9:18895423-18895445 CACATTGGGGGGAGGGGGTGGGG - Intronic
1052948716 9:34190332-34190354 CAGACTGGAGTGCAGTGGTGTGG + Intronic
1053062454 9:35043033-35043055 ACCACAGGATGGCTGGGGTGGGG - Exonic
1053330061 9:37197180-37197202 CACACTAGAGGCTGGGGGTGGGG - Intronic
1054929704 9:70623319-70623341 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1055854414 9:80668956-80668978 CACATTGGGAGGCTGAGGTGGGG - Intergenic
1056802085 9:89699224-89699246 GACACAGCAGGTCTGGGGTGGGG + Intergenic
1057003025 9:91530398-91530420 CCCTTTGGAGGGCTGGGGAGGGG + Intergenic
1057038494 9:91830425-91830447 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1057098722 9:92337688-92337710 CACTGTTGAAGGCTGGGGTGTGG - Intronic
1057211806 9:93204584-93204606 CCCACTGAGGGGCAGGGGTGGGG + Intronic
1057346377 9:94254552-94254574 CACTTTGGAAGGCTGAGGTGGGG - Intergenic
1057389683 9:94632626-94632648 CAGGCTGGAGGGCTGTGGTGTGG - Intronic
1057508286 9:95654856-95654878 CACTTTGGGAGGCTGGGGTGGGG + Intergenic
1057710609 9:97439534-97439556 CACAGAGTAGGGCTGGGGTGAGG - Intronic
1057958659 9:99433692-99433714 CACACTGAGGGGCTGGGCAGGGG + Intergenic
1058470953 9:105278291-105278313 CAGACTGGAGTGCAGTGGTGCGG + Intronic
1058716535 9:107727382-107727404 AACAATGGAGGACTGGAGTGGGG - Intergenic
1058745770 9:107989176-107989198 CACTCTGGAGGGTTGGGGGTTGG + Intergenic
1058758334 9:108104589-108104611 CGCTCAGGATGGCTGGGGTGAGG + Intergenic
1059317095 9:113435213-113435235 CAAACTGGAGTGCAGTGGTGTGG + Intergenic
1060212051 9:121716609-121716631 CACACTGGGGTGCTGGGACGGGG - Intronic
1060294270 9:122332591-122332613 CACACTGGACATCTGGGTTGTGG - Intergenic
1060479763 9:124011403-124011425 GAGGCTGGAGGGCGGGGGTGGGG - Intronic
1061508725 9:131047604-131047626 CACTCTGGGAGGCCGGGGTGGGG + Intronic
1061642459 9:131969953-131969975 GAGGCTGGAGGGCTGGGGGGGGG + Intronic
1061667888 9:132170882-132170904 GTCTCTGGAGCGCTGGGGTGGGG + Intronic
1061917987 9:133766604-133766626 CACACTGGAGGGGGAGGGGGAGG + Intronic
1062307966 9:135920288-135920310 GACAATGGGGGGCTGGGGTTGGG + Intergenic
1062352765 9:136147377-136147399 CACCCTGGGGGGCTGTTGTGAGG - Intergenic
1062474034 9:136718863-136718885 GGCAGTGGAGGACTGGGGTGTGG + Intronic
1062617972 9:137406771-137406793 CCCAGAGGAGGGCTGGGGAGAGG - Intronic
1062626628 9:137445964-137445986 CACCCTTGAGACCTGGGGTGTGG - Intergenic
1062675905 9:137743721-137743743 CAGACAGGTGGGCTGTGGTGAGG - Intronic
1062682240 9:137788120-137788142 CTCAGAGGAGGGCAGGGGTGGGG + Intronic
1203769386 EBV:41124-41146 CACCCCGGGGTGCTGGGGTGGGG - Intergenic
1203789664 EBV:144043-144065 CACCCCGGGGTGCTGGGGTGGGG - Intergenic
1203364679 Un_KI270442v1:247472-247494 CACCCTGGAAGGGTGGAGTGTGG - Intergenic
1185488017 X:497952-497974 CACGTTGGAGGCCTGGGATGAGG + Intergenic
1185615343 X:1418656-1418678 CACTGTCCAGGGCTGGGGTGGGG + Intronic
1185646975 X:1622865-1622887 CAGGCTGGAGGGCAGTGGTGCGG - Intronic
1185671713 X:1815092-1815114 CAAACTGGAGTGCAGTGGTGAGG - Intergenic
1185893985 X:3842918-3842940 CACACTGGGAGGCTGGCCTGAGG + Intronic
1185899102 X:3881342-3881364 CACACTGGGAGGCTGGCCTGAGG + Intergenic
1185904219 X:3919771-3919793 CACACTGGGAGGCTGGCCTGAGG + Intergenic
1185953498 X:4462741-4462763 CAGACTGGAGTGCAGTGGTGAGG - Intergenic
1186350195 X:8732200-8732222 CGCCCTCGAGGGGTGGGGTGAGG + Intergenic
1186516900 X:10173239-10173261 GATCCTGGAGAGCTGGGGTGTGG - Intronic
1187793107 X:22972142-22972164 GACAGTGTGGGGCTGGGGTGGGG + Intergenic
1188837747 X:34978830-34978852 AACTCTGGAGGGCTGGTGTCAGG - Intergenic
1189204079 X:39222628-39222650 CACACTGGACAGCTGGTGTCAGG + Intergenic
1189570978 X:42296682-42296704 CACTTTGGGAGGCTGGGGTGGGG + Intergenic
1190032997 X:46992303-46992325 CACACAGGGAAGCTGGGGTGGGG - Intronic
1190222783 X:48522995-48523017 CAGACTGGAGGGCAGTGATGTGG + Intronic
1190277078 X:48905571-48905593 CACAATGGAGGGACAGGGTGGGG + Intronic
1192185130 X:68941595-68941617 CAACCTGCAGGGCGGGGGTGGGG - Intergenic
1192237375 X:69304548-69304570 CAGGCTGGAGTGCAGGGGTGGGG - Intergenic
1192443745 X:71194744-71194766 CAAGCTGGAGTGCTGGAGTGCGG + Intergenic
1193019394 X:76774926-76774948 GACAGTGGAGGGCTGGGGGAGGG - Intergenic
1193140507 X:78021941-78021963 CGCACTGGGAGGATGGGGTGGGG + Intronic
1193754067 X:85384961-85384983 TACACAGTAGGTCTGGGGTGGGG - Intergenic
1194593849 X:95835043-95835065 CACTTTGGAAGGCTGAGGTGGGG - Intergenic
1194597248 X:95873596-95873618 CACACTGGAGGTGTGGGTTGAGG + Intergenic
1194662539 X:96642891-96642913 CGCACTGGGAGGATGGGGTGGGG - Intergenic
1195099321 X:101539297-101539319 AACGCTGGAGGCCGGGGGTGCGG + Intergenic
1195135797 X:101906505-101906527 CAGCCTGGAGGGCAGGGCTGTGG - Intronic
1195668135 X:107449044-107449066 CACACTCCAGTGCTGGGGAGAGG + Intergenic
1195895690 X:109744071-109744093 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1196515546 X:116606399-116606421 CCCACTGAAGTGATGGGGTGGGG + Intergenic
1196679480 X:118456066-118456088 GATTCTGGAGGTCTGGGGTGGGG - Intergenic
1196829463 X:119764895-119764917 CACTCTGGGAGGCTGAGGTGAGG + Intergenic
1197862846 X:130988449-130988471 GACACTGGGGAGTTGGGGTGTGG + Intergenic
1198530792 X:137548497-137548519 CACCTGGCAGGGCTGGGGTGGGG + Intergenic
1198671945 X:139090692-139090714 CACTTTGGGAGGCTGGGGTGGGG + Intronic
1198867019 X:141133919-141133941 GAGACTGGAGGGCAGGAGTGAGG + Intergenic
1199676632 X:150195085-150195107 CACATTGGCTGGCAGGGGTGTGG + Intergenic
1200102562 X:153695271-153695293 CCCCCTGGAGGGGTGCGGTGGGG - Exonic
1200254575 X:154573260-154573282 CAATCTGCAGAGCTGGGGTGGGG - Intergenic
1200263194 X:154631148-154631170 CAATCTGCAGAGCTGGGGTGGGG + Intergenic