ID: 1044569449

View in Genome Browser
Species Human (GRCh38)
Location 8:93700708-93700730
Sequence ACACTGGAGGGCTGGGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 11, 3: 44, 4: 538}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044569429_1044569449 23 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569449 8:93700708-93700730 ACACTGGAGGGCTGGGGTGAGGG 0: 1
1: 0
2: 11
3: 44
4: 538
1044569434_1044569449 3 Left 1044569434 8:93700682-93700704 CCGAGCCCAGCTGCCCAGGGCCG 0: 1
1: 0
2: 7
3: 59
4: 531
Right 1044569449 8:93700708-93700730 ACACTGGAGGGCTGGGGTGAGGG 0: 1
1: 0
2: 11
3: 44
4: 538
1044569430_1044569449 14 Left 1044569430 8:93700671-93700693 CCGGTAACAGCCCGAGCCCAGCT 0: 1
1: 0
2: 1
3: 2
4: 121
Right 1044569449 8:93700708-93700730 ACACTGGAGGGCTGGGGTGAGGG 0: 1
1: 0
2: 11
3: 44
4: 538
1044569438_1044569449 -10 Left 1044569438 8:93700695-93700717 CCCAGGGCCGCCCACACTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 175
Right 1044569449 8:93700708-93700730 ACACTGGAGGGCTGGGGTGAGGG 0: 1
1: 0
2: 11
3: 44
4: 538
1044569428_1044569449 24 Left 1044569428 8:93700661-93700683 CCCTGGAAAACCGGTAACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1044569449 8:93700708-93700730 ACACTGGAGGGCTGGGGTGAGGG 0: 1
1: 0
2: 11
3: 44
4: 538
1044569435_1044569449 -2 Left 1044569435 8:93700687-93700709 CCCAGCTGCCCAGGGCCGCCCAC 0: 1
1: 0
2: 0
3: 42
4: 376
Right 1044569449 8:93700708-93700730 ACACTGGAGGGCTGGGGTGAGGG 0: 1
1: 0
2: 11
3: 44
4: 538
1044569436_1044569449 -3 Left 1044569436 8:93700688-93700710 CCAGCTGCCCAGGGCCGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 426
Right 1044569449 8:93700708-93700730 ACACTGGAGGGCTGGGGTGAGGG 0: 1
1: 0
2: 11
3: 44
4: 538
1044569433_1044569449 4 Left 1044569433 8:93700681-93700703 CCCGAGCCCAGCTGCCCAGGGCC 0: 1
1: 5
2: 16
3: 75
4: 777
Right 1044569449 8:93700708-93700730 ACACTGGAGGGCTGGGGTGAGGG 0: 1
1: 0
2: 11
3: 44
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044569449 Original CRISPR ACACTGGAGGGCTGGGGTGA GGG Intronic
900150265 1:1175627-1175649 AGTCTGCAGGGCTGTGGTGATGG - Intronic
900408598 1:2503081-2503103 AGACAGGAGGGCTGGGGCTATGG - Intronic
900483667 1:2911240-2911262 ACGCTGGAGGCGTGGGATGATGG + Intergenic
900713651 1:4130366-4130388 AGACTGGAGGGCTGGGGTGGAGG + Intergenic
901027253 1:6285163-6285185 ACCCACGAGGGCTGGGGTGTGGG + Intronic
901066102 1:6495358-6495380 GCACAGGAGGGCCGTGGTGAGGG - Intronic
901110422 1:6789007-6789029 AAACTGGAGGTAAGGGGTGAAGG - Intronic
901127241 1:6938323-6938345 AGACTGGTTGGCTGGGGTCAGGG + Intronic
901208925 1:7513511-7513533 ACACTGGAAGCCAGGGGAGAGGG - Intronic
901387735 1:8922119-8922141 ACGGTGGAGGGTCGGGGTGATGG - Intergenic
901814741 1:11787719-11787741 AGGCTGGAGGCCTGGGGAGATGG + Exonic
902166530 1:14576370-14576392 ACAATGGATGGCTGGGTGGATGG + Intergenic
902234634 1:15049474-15049496 ACACTGGGGGGCTGGGGTGGAGG - Intronic
902449274 1:16486354-16486376 AAACTGGAGAGTTGGGGAGAAGG - Intergenic
902468673 1:16633069-16633091 AAACTGGAGAGTTGGGGAGAAGG - Intergenic
902505469 1:16936923-16936945 AAACTGGAGAGTTGGGGAGAAGG + Intronic
902653541 1:17852373-17852395 ACCCTGGAGGGCAGGGGTGATGG - Intergenic
903060279 1:20664285-20664307 ACACTGGTGGGCATGGGTGTGGG + Exonic
903154452 1:21434590-21434612 AAACTGGAGAGTTGGGGAGAAGG + Intergenic
903549878 1:24150554-24150576 AGAGGGGAGGGCTGGGGTAATGG - Intergenic
903912623 1:26738915-26738937 AGGCTGGAGGGCTGGAGTGCTGG + Intronic
904393283 1:30199626-30199648 ATTCTGGGGGGCTGGGGAGAGGG - Intergenic
904402680 1:30267131-30267153 ACCCTGCAGGGCTGTGGGGAGGG + Intergenic
904403789 1:30273453-30273475 ACAGGGGAGGGCTGTGGTCAGGG - Intergenic
904796494 1:33060152-33060174 ACACTGCAGGGCGGGCGTGGTGG + Intronic
905262974 1:36732167-36732189 AGACTGGTGGGCTGGGGCGGAGG + Intergenic
905390086 1:37630639-37630661 CCGCTGGCCGGCTGGGGTGATGG + Intronic
905460947 1:38122752-38122774 ACACTGGAGGGTGGGGTTGGGGG + Intergenic
906264263 1:44416983-44417005 AATGGGGAGGGCTGGGGTGAGGG + Intronic
906357247 1:45117186-45117208 ACAGTGGAGTGTTAGGGTGAAGG + Intronic
906974774 1:50558378-50558400 ACACTGGTGGGGTCGGGGGACGG + Intronic
908255489 1:62300053-62300075 ACACCAGAGGACTGTGGTGAAGG - Intronic
910928258 1:92418188-92418210 ACACTGCAGGACTGGGGTCAGGG - Intergenic
910939998 1:92523001-92523023 ACCTTGGAAGGCTGAGGTGAGGG - Intronic
911154664 1:94626052-94626074 ACAGAGGGGAGCTGGGGTGAAGG - Intergenic
911183790 1:94883933-94883955 ACAGAGGGGTGCTGGGGTGAAGG + Intronic
912511010 1:110190159-110190181 ACAGGGGTGGGCTGGGGAGAGGG + Intronic
912718513 1:112000312-112000334 ACAGTGGCTGGCTGGGGTCAAGG - Intergenic
912791263 1:112653442-112653464 ACACTGGATGTCTGGGGAGAAGG + Intronic
912942317 1:114056142-114056164 AGAGAGCAGGGCTGGGGTGATGG + Intergenic
913048094 1:115090093-115090115 CCACTGGCCGGCTGGGTTGAGGG - Intergenic
913068401 1:115278719-115278741 GCACTGGAGGCCTGAGGTGGAGG - Intergenic
913168572 1:116211667-116211689 ACAGTGGCGGGGTGGGGTGCAGG + Intergenic
914913787 1:151805915-151805937 AAACTGCAGGGGTCGGGTGAGGG + Exonic
915485030 1:156214260-156214282 ACACTGATGTGCTGGGGTGGTGG - Intronic
916446860 1:164880724-164880746 ACACTAGAGGGCTTGGGAGGGGG - Intronic
917174907 1:172223224-172223246 AGACTGGAGAGGTGGGGTTAGGG - Intronic
917305866 1:173623943-173623965 ACACTGTGGGGGTGGGGGGAGGG + Intronic
917936141 1:179869127-179869149 ACACAGTTGGGCTGGGGTGGTGG - Intronic
919949815 1:202352599-202352621 ACACTGGCGGCCGGGGGTGGTGG + Intronic
920288896 1:204902602-204902624 CCAGTGGAGGGGTGGGGAGAAGG + Intronic
920415660 1:205797817-205797839 ACCCTGGAGAGATGGGGTGGGGG - Intronic
921407687 1:214799167-214799189 ACACTGGGGTCCTGGGGTAAGGG + Intergenic
921432833 1:215083137-215083159 ACACCGGCGGGCTGGGCAGAGGG - Intronic
921990442 1:221360358-221360380 ACTTTGGAGGGCTGAGGTGAGGG - Intergenic
923031343 1:230251315-230251337 ACCCTGGAGGACAGGGGAGAAGG + Intronic
924210671 1:241763891-241763913 ATCCTGGAGGGCTGGGGAGACGG + Intronic
924640599 1:245829952-245829974 GGACTGGGGGGCTGGGGAGATGG + Intronic
1062831313 10:607917-607939 ACACTGAGGGGCTGTGGTGTGGG - Intronic
1062912569 10:1221565-1221587 ACTGTGGTGGGGTGGGGTGAGGG - Intronic
1063395455 10:5683530-5683552 CCACTGGGGGGCTGGGATTACGG - Intergenic
1063673479 10:8118558-8118580 AGACTGGAGGGCAGGAGTGGAGG + Intergenic
1064270993 10:13865896-13865918 ACACTGTGGGGCGGGGCTGAGGG + Intronic
1065020111 10:21496249-21496271 ACTGGGGAGGGCTGGGGTGCGGG - Intronic
1066303507 10:34117426-34117448 AGACTGGAGGGCAGTGGGGAGGG + Intronic
1067333199 10:45340678-45340700 TCACTGAAGGGCAGTGGTGAAGG + Intergenic
1067711615 10:48655475-48655497 AAAGGCGAGGGCTGGGGTGAGGG - Intronic
1068525560 10:58125532-58125554 ACACTGAAGGGCAGGGGGCAGGG + Intergenic
1068590259 10:58845937-58845959 ACACTGGAGGGCTGAGATGATGG + Intergenic
1069193413 10:65519290-65519312 TCACTGCAGGCCTGGGGTGGTGG - Intergenic
1069581237 10:69568541-69568563 AGAGTGGAGGGGTGGGGTGGGGG - Intergenic
1069777565 10:70935837-70935859 ACCCTGGAGGGCTGGACAGATGG - Intergenic
1069782334 10:70964823-70964845 ACACTGGAGGGCGGGCAGGATGG - Intergenic
1069867902 10:71515029-71515051 ACACTGGAGGGCTGAGGGGGTGG - Intronic
1070159309 10:73856174-73856196 ACCCTGCAGAGCTGGTGTGAGGG - Intronic
1070162287 10:73873860-73873882 CCACTGCAGGGGTGGGGGGAGGG + Intronic
1070728365 10:78807899-78807921 AGAGAGCAGGGCTGGGGTGAAGG + Intergenic
1070824475 10:79382752-79382774 ATGCTGGAGGGCTGGTGTAAGGG + Exonic
1071297853 10:84235320-84235342 CCACTGGTGAGATGGGGTGAGGG - Intronic
1071461190 10:85897866-85897888 ACAGTGGGGGGTTGGGGAGATGG - Intronic
1071566565 10:86674292-86674314 ACACTGGAGGGCTTGGAGGCTGG + Intronic
1072445969 10:95498988-95499010 ACACTGGGGAAGTGGGGTGAAGG + Intronic
1072783920 10:98267971-98267993 CGACTGGAGGGCCGGGCTGAGGG + Intronic
1073057042 10:100709711-100709733 GAACTGGAAGGCTGGGGTGGGGG - Intergenic
1073060944 10:100733275-100733297 ACAGTGCAGGACAGGGGTGAGGG + Intergenic
1073101384 10:101008506-101008528 AGTCTGGAGGGCTGGGGAGGGGG + Intronic
1074123820 10:110512655-110512677 CCACTGGAGAGCTGGGGGAAGGG - Intergenic
1074360225 10:112819863-112819885 ACACTTCAGGGCAGGGGTGTTGG + Intergenic
1075018520 10:118929119-118929141 TCACTGGTGGGCAGAGGTGAGGG - Intergenic
1076450740 10:130555369-130555391 ACAGTGGAAGGCTGGGGTTGAGG + Intergenic
1076801088 10:132828939-132828961 ACAGTGGAGCGCAGGCGTGACGG - Intronic
1076844185 10:133060940-133060962 ACCGTGGAGGCCTGGGGTGCTGG - Intergenic
1076917098 10:133429653-133429675 ACACTGGGTGGCTGTGATGAGGG + Intergenic
1076937192 10:133574410-133574432 ACACTGGGTGGCTGTGATGAGGG + Intergenic
1078159996 11:8832096-8832118 ACTCTGGAAGGCGGGGGTGAGGG - Intronic
1079764185 11:24370030-24370052 ACACTGGAGCCCGTGGGTGAGGG - Intergenic
1081913987 11:46719341-46719363 AGGCTGGAGGACTGGGGTGTGGG + Intronic
1083159380 11:60845380-60845402 ACATAGGCGGGCAGGGGTGAAGG + Intronic
1083579845 11:63818059-63818081 ATCCTGGAGGCCTGGAGTGAAGG + Exonic
1083769000 11:64856046-64856068 ACCCCGCAGGGCTGTGGTGAGGG - Intronic
1085302846 11:75468454-75468476 ACAACGGAAGGCTGGGTTGAGGG + Intronic
1086034841 11:82403813-82403835 ACAGTGCAGGGCCGGGCTGAAGG - Intergenic
1087290992 11:96320298-96320320 ACACTGGGAGGCTGGAGTAAGGG + Intronic
1088706491 11:112468696-112468718 CCACTCAAGGGCAGGGGTGAAGG - Intergenic
1089111789 11:116063109-116063131 ACAGGGGAGGGATGGGGTGAGGG + Intergenic
1089142837 11:116301221-116301243 ACACTGGTTGGCTGAGGAGATGG - Intergenic
1089624483 11:119742535-119742557 ACACTGGGGGGATGGGGAGGCGG - Intergenic
1089638811 11:119833451-119833473 ACAGAGGAGGTCTGGGGAGAGGG + Intergenic
1089794430 11:120968853-120968875 ACACTGTAGGGCTGCTGTGAAGG + Intronic
1090364288 11:126193005-126193027 AGGCTGGAGGTCTGGGATGAGGG + Intergenic
1092181661 12:6450821-6450843 TGACAGGAGGGCTGGGCTGAGGG + Intronic
1092283416 12:7114470-7114492 ACACCAGAGGGTTGGTGTGAGGG + Intergenic
1092838231 12:12512479-12512501 GGGCTGGAGGGCTGGGGTAATGG - Intronic
1095353618 12:41244644-41244666 ACATTGGTGTGCTTGGGTGAAGG - Intronic
1095385575 12:41646048-41646070 ACAGTGGGGGGCCAGGGTGAGGG - Intergenic
1096262772 12:50103494-50103516 CCACTGCAGGGCTGGGGTGGGGG - Intergenic
1096782988 12:54001507-54001529 GCACAGGAGGGCTAGGGTGGGGG + Intronic
1098201290 12:68058665-68058687 CTGCTGGAGGGCTGGGGAGAGGG - Intergenic
1100185478 12:92134444-92134466 GCACTGGTGGGCTGTGGTGGTGG - Intronic
1100362225 12:93889523-93889545 GCAGTGGAGGGCAAGGGTGAGGG - Intronic
1100611755 12:96195935-96195957 AGGCTGGAGGACTGGGGTGGGGG - Intronic
1100746412 12:97651281-97651303 ACTGTGGTGGGGTGGGGTGAGGG - Intergenic
1101490329 12:105204063-105204085 ACCCTGGAGGGCAGGGGTATGGG + Intronic
1101650346 12:106671947-106671969 ACACTGGAGGCCGGGTGTGGTGG - Intronic
1101676582 12:106922425-106922447 GCAGTGGGGGGCTGGAGTGAGGG - Intergenic
1101822737 12:108196236-108196258 ACACTGAGGGGCTGGGGAGAAGG + Intronic
1102858606 12:116316341-116316363 GAAGTGGAGGTCTGGGGTGATGG - Intergenic
1103506679 12:121445735-121445757 AAATTAGAGGGCTGGAGTGAGGG + Intronic
1103910329 12:124348561-124348583 ACCCTGGAGGGCTAGGGTACAGG - Intronic
1105405268 13:20127998-20128020 ACACTGGCGGGCAGGGGACATGG - Intergenic
1105800210 13:23896557-23896579 ACCCAGGAGGGCAGGGGTCATGG + Intronic
1105848803 13:24316419-24316441 ACCCAGGAGGGCAGGGGTCATGG - Intronic
1106193744 13:27476123-27476145 ACACTGGGGGCCTGGGATGGAGG - Intergenic
1106606040 13:31230221-31230243 ATACTGGAGGTTTGGAGTGAGGG + Intronic
1106851279 13:33795537-33795559 ACAGTGGTGGGCTGGGGTGGCGG - Intergenic
1107396991 13:40028162-40028184 ACAGTGGGAGGCTGGAGTGAAGG - Intergenic
1108437131 13:50411562-50411584 AGACTGCATGGCTGGTGTGAGGG + Intronic
1108837266 13:54567135-54567157 ACAATTGAGGGCTGGTCTGATGG - Intergenic
1110862067 13:80355458-80355480 ACAGTGCAGGGGTGGGCTGAAGG - Intergenic
1111577088 13:90169357-90169379 AAAAAGGAGGGCTGGGGTTAAGG + Intergenic
1111751793 13:92342093-92342115 ACACTGGAAGTGTGTGGTGATGG - Intronic
1112275868 13:98018901-98018923 ACCCTGGAAGGCTGGGGGCAGGG - Intronic
1112389467 13:98969820-98969842 AGACTGGAAAGCTGGGGTCAGGG + Intronic
1112428014 13:99322574-99322596 ACAGTGAAGGGCTGCGTTGAAGG - Intronic
1112488898 13:99844329-99844351 ACACTGCAGGACTGTTGTGAGGG + Intronic
1112602406 13:100869231-100869253 CCACTTGTGGGCTGGGGTGGTGG + Intergenic
1113375205 13:109759012-109759034 ACACAAGAGAGCTGAGGTGAGGG + Intronic
1113661842 13:112112933-112112955 GCACTGGAGGGCTTGGAGGAAGG - Intergenic
1117322861 14:54640701-54640723 ACAATTGAGGGCTGGGGTGAGGG - Intronic
1117341842 14:54798309-54798331 ACACTGGGGGCCTGCAGTGAGGG - Intergenic
1117442283 14:55771327-55771349 ACACTGGTGGTCTGGAGAGAGGG + Intergenic
1117462946 14:55964297-55964319 ACACTGGAGGGTTGGAGTAGGGG - Intergenic
1117465388 14:55988331-55988353 ACTCTGGTGGGGTGGGGGGAAGG - Intergenic
1118852408 14:69594063-69594085 GCACTGGAGGCCAGGGGTGGTGG + Intergenic
1118910810 14:70060461-70060483 ACAGTGTAGGGGTGGGGTGGGGG + Intronic
1118983377 14:70733417-70733439 AGACAGGAGGCCTGGGGTGAGGG - Intronic
1119619005 14:76117811-76117833 ACAGTGGAGGGTTCTGGTGATGG - Intergenic
1119977573 14:79042255-79042277 AAACTGGAAGGCTAGGCTGATGG + Intronic
1120666248 14:87309857-87309879 GCCCTGGAGGGCAGGAGTGATGG - Intergenic
1121314996 14:92955829-92955851 AAATTGGAAAGCTGGGGTGAGGG + Intronic
1121454577 14:94030095-94030117 CCACTGGAGGGCATGGGGGAAGG + Intronic
1122073471 14:99220559-99220581 AGAATGGGGGGCTGGGGAGAGGG + Intronic
1122134628 14:99625673-99625695 GCCCTGGAGGGCTCTGGTGATGG + Intergenic
1122587441 14:102819111-102819133 AGGATGCAGGGCTGGGGTGATGG - Intronic
1122705010 14:103615436-103615458 CCACTGGGGGGCTGGGGTGGGGG - Intronic
1122740052 14:103867079-103867101 ACACTGCAGGGCTGGGGGGGTGG + Intergenic
1122762658 14:104041096-104041118 ACACTGAAGGGCCGGGGGAAAGG + Intronic
1122807463 14:104267216-104267238 ACAGAGGAGGTCTGGGGTGAGGG - Intergenic
1122981370 14:105193710-105193732 GCACTGAGGGGCTGTGGTGAGGG + Intergenic
1123140851 14:106076546-106076568 AGAGTGGAGGGAGGGGGTGATGG + Intergenic
1123158641 14:106255429-106255451 AGAGTGGAGGGAGGGGGTGATGG + Intergenic
1123670106 15:22647882-22647904 CTACTGGGGGGCTGGGGGGAAGG + Intergenic
1124906336 15:33872144-33872166 ACACTCCAGTGCTGGGGAGAGGG + Intronic
1124945623 15:34262821-34262843 GCACTGGTGGGAGGGGGTGAGGG - Intronic
1125180736 15:36879027-36879049 ACACTAGAGAGCTGGGCTCAGGG + Intergenic
1125413298 15:39427321-39427343 CCACAGGAAAGCTGGGGTGAGGG - Intergenic
1125485535 15:40108617-40108639 GAACTGGGGCGCTGGGGTGAGGG - Intronic
1125502598 15:40248730-40248752 ACACAAGAGGGCTGGGGTGCGGG - Intronic
1126466333 15:48964466-48964488 ACACTGGGGGTGTGGGGTGTCGG + Intergenic
1127702981 15:61519146-61519168 GCACTTGCAGGCTGGGGTGATGG + Intergenic
1130903816 15:88226260-88226282 GCATTGGAGGGCAGGGATGAAGG - Intronic
1131166181 15:90143681-90143703 ACACTGCAGGACTGGGGCCAGGG - Intergenic
1131491863 15:92870049-92870071 ACATTTGAGGGCTGTGGGGAGGG + Intergenic
1131510036 15:93044736-93044758 ACACTGCAGGGGCGGGGCGAGGG + Intronic
1132203069 15:99968384-99968406 AGACTTTAGGGCTGGGGTGGGGG + Intergenic
1132251557 15:100339499-100339521 TCACTGTAGGGCTCGGGTCAAGG - Intronic
1132355431 15:101168064-101168086 TGACTGGGGGGCTGTGGTGATGG + Intergenic
1132399699 15:101497746-101497768 ACACGGGTGTGCTGGGGTGAAGG - Intronic
1132676503 16:1123393-1123415 ACACGGGAGGCCGGAGGTGAAGG - Intergenic
1132687959 16:1170168-1170190 ACCCGGGTGGGCTGGGGTCAGGG - Intronic
1132788844 16:1673639-1673661 ACATCTGATGGCTGGGGTGAGGG - Intronic
1133056000 16:3145763-3145785 GCCCTGGAGGCCTGAGGTGAGGG + Exonic
1133966014 16:10532183-10532205 ATTCTGTAGGTCTGGGGTGAGGG + Exonic
1134059298 16:11189255-11189277 ACACTGGAGAGCTTGGCCGAGGG + Intergenic
1135170411 16:20178735-20178757 GCTCTGGAGGGCTAGGGTGTGGG - Intergenic
1135508027 16:23055892-23055914 ACACAGGAAGGCTGGGGTGTAGG + Intergenic
1138649248 16:58449335-58449357 ACAGAAGAGGGCTTGGGTGAGGG + Intergenic
1139594887 16:67951693-67951715 ACACTGGGGGGCTGGGAAGGCGG + Intronic
1139914686 16:70420839-70420861 ACTCTGGAGGGCTGGGTGGGAGG - Intronic
1139950121 16:70664492-70664514 ACCCTGGTGGGCTGGGGGCAAGG - Intronic
1140407360 16:74719565-74719587 AGACTGGAGTGCTGGAGTGCTGG + Intronic
1140804547 16:78520935-78520957 ACAGTGGCGTGCTGGGGTCAGGG + Intronic
1141070933 16:80954222-80954244 ACAGAGGAAGGCTGGGCTGATGG + Intergenic
1141205896 16:81932900-81932922 ACACTGGAGGGCAGAAGAGATGG - Intronic
1141941011 16:87276273-87276295 TCACTGGAGTGCTTGGGGGAGGG - Intronic
1142979461 17:3663322-3663344 ACACACGAGGGCTGGGGGGCAGG + Exonic
1143295840 17:5871388-5871410 ACACTGGAGGTCAGGTGTGGTGG + Intronic
1143318547 17:6052394-6052416 TCACTGGAGGCATGGGGAGATGG + Intronic
1143477489 17:7211165-7211187 AGACTGGGGGGCTGGGGCGGTGG + Intronic
1144520922 17:15951772-15951794 GAACTGGAGGGCAGGGGAGATGG + Intronic
1144825945 17:18105821-18105843 ACAGTGGAGGGCGGTGGGGAGGG - Intronic
1144892323 17:18501092-18501114 ACACAGGATGGCTGGGGAGCTGG + Intergenic
1144941834 17:18947553-18947575 TCACTGGAGGAGCGGGGTGACGG + Intergenic
1144961171 17:19044960-19044982 ACAATGGAGGCCTGGGCTGGAGG + Intronic
1144973990 17:19129564-19129586 ACAATGGAGGCCTGGGCTGGAGG - Intronic
1145139891 17:20443196-20443218 ACACAGGACGGCTGGGGAGCTGG - Intergenic
1145795964 17:27655475-27655497 ACACAGGATGGCTGGGGAGCTGG + Intergenic
1145810414 17:27760800-27760822 ACACAGGATGGCTGGGGAGCTGG + Intronic
1146517634 17:33501859-33501881 ATTGTGGAGGGCTGGGGTAAGGG + Intronic
1147215847 17:38898626-38898648 ACCCTGGAGGGCAGGGGTAGTGG - Intronic
1147312725 17:39604919-39604941 AGACTGGAGGTTGGGGGTGAGGG + Exonic
1148063802 17:44854229-44854251 ACCCTCGAGGACTGGGGTGGGGG + Intronic
1148215100 17:45830006-45830028 ACACATCTGGGCTGGGGTGATGG + Intronic
1148444940 17:47731730-47731752 ACTGGGGAGGACTGGGGTGAAGG + Intergenic
1149007908 17:51824656-51824678 AGAGTGCAGGGCTGGGGTCAGGG - Intronic
1149402412 17:56312077-56312099 ACACTGGGTGGTGGGGGTGAAGG - Intronic
1149551484 17:57543413-57543435 GCCCTGGAAGGCTGGGGGGACGG + Intronic
1149853545 17:60057251-60057273 AATCAGGAGGGCTGAGGTGAGGG + Exonic
1150242688 17:63648014-63648036 CCCCAGGAGGGCTGGGGAGAAGG + Intronic
1150289658 17:63973935-63973957 GCTCTGGAGGGCTGGGCAGAAGG - Intergenic
1151338771 17:73456453-73456475 ACACTGTAGGGCAGGGGAGGAGG - Intronic
1151393621 17:73804453-73804475 AGACTGCAGGGCAGGGGAGAAGG - Intergenic
1151538098 17:74749795-74749817 ACACCGGCGGGCTGCGGAGAGGG - Intronic
1151548368 17:74807108-74807130 ACACTGGCGGGGTGGGGTGGGGG - Intronic
1151757071 17:76081188-76081210 AGACTGGAGCCCAGGGGTGATGG - Intronic
1151865906 17:76802589-76802611 ACAGTGGAGGGCTGGGCACATGG + Intergenic
1152747588 17:82048543-82048565 CCCCTGGTGGGCTGCGGTGATGG - Exonic
1152982682 18:293383-293405 ACCCTGGAGATGTGGGGTGAGGG + Intergenic
1153670092 18:7403281-7403303 ACTGTGGTGGGGTGGGGTGAGGG + Intergenic
1154999790 18:21674931-21674953 GAACTGGAGGGATGGGGTGGGGG + Intronic
1155118931 18:22798620-22798642 ACTTTGTAGCGCTGGGGTGAGGG + Intronic
1156656877 18:39298719-39298741 ACACTGGAGGTCTGGAGGTAAGG + Intergenic
1157340320 18:46772191-46772213 AACCTGGAGGACTGGGGTGGGGG + Intergenic
1157504707 18:48218202-48218224 ACTGTGCAGGCCTGGGGTGAGGG - Intronic
1157568686 18:48697916-48697938 GGACTGCAGGGCTGGGGTGATGG - Intronic
1158449058 18:57547229-57547251 ACTCTGGAGGACTGTTGTGAAGG + Intergenic
1158835512 18:61327514-61327536 AGACTGAAGGGATGGGGTGCAGG - Intergenic
1159985020 18:74831740-74831762 GCACAGCAGGGCAGGGGTGAGGG - Intronic
1160754116 19:748702-748724 ACACAGGAGGCCTGGGGAGGAGG + Intergenic
1161266969 19:3368637-3368659 CCACTACAGGGCTGGGGTGGAGG - Intronic
1161313502 19:3607413-3607435 AGCCGGGAGGGCTGGGGTGATGG + Intergenic
1161348989 19:3782219-3782241 ACACAGGAGTGCTTGGGAGAAGG - Intronic
1161702394 19:5802592-5802614 ATGATGGAGGGCTGGGGTGGGGG + Intergenic
1161946743 19:7442075-7442097 AGAGTGGAGGGCCGGTGTGATGG - Intronic
1162472630 19:10881602-10881624 CCCCTGGAGGGCTGGGGTGGGGG + Intronic
1162814382 19:13184475-13184497 ACACTGCAGGCCTGGCGTGGTGG + Intergenic
1162968221 19:14165704-14165726 AGACTGGAGGGGTGTGGTGAGGG + Intronic
1164137571 19:22428107-22428129 AATCTGGAGGGCGGAGGTGAGGG - Intronic
1164229095 19:23272302-23272324 AGACTGGAGGGCTGCTGTAAAGG + Intergenic
1164734639 19:30531910-30531932 ACACTGGAGGCCAGGTGTGGTGG - Intronic
1164845994 19:31433013-31433035 CCACTGCAGGGCAGAGGTGAGGG - Intergenic
1164980592 19:32610825-32610847 CCACTGGAGGCCTGGTGTGGTGG + Intronic
1165090167 19:33382791-33382813 ACACTGGACGGCTGGGGGTAGGG + Intergenic
1165266872 19:34668106-34668128 ACAGTGCAGCGCTGGGCTGAAGG - Intronic
1165658354 19:37552701-37552723 ACTCTGGAAGGCTGAGGTGGTGG + Intronic
1166732996 19:45069134-45069156 GAAAGGGAGGGCTGGGGTGACGG + Intronic
1166785631 19:45365018-45365040 TTACTGGAGGGCAGGGCTGAGGG - Intronic
1166831451 19:45642039-45642061 ACACTGGAGGGATGGGGTTAGGG + Exonic
1166979643 19:46624985-46625007 AGACTGGAGAGGTGCGGTGAGGG - Exonic
1167042115 19:47028400-47028422 ACACTAGGGGGCTGGGGAGGCGG + Intronic
1167278854 19:48554560-48554582 TCACTGGATGGCTGGGAGGAGGG - Intronic
1168397282 19:56059247-56059269 AGTCTGGAGGGCTGAGTTGATGG + Intronic
1168611422 19:57803866-57803888 AAACCGCAGGGCTGGGGAGAGGG + Intronic
925180243 2:1812931-1812953 TGAGAGGAGGGCTGGGGTGAGGG + Intronic
925465643 2:4105476-4105498 TCACTGCAGGACTGGGGTGCCGG + Intergenic
925741593 2:7009766-7009788 AGGCTGGAGGGCTGTGGTTAAGG - Intronic
926241600 2:11093126-11093148 AGTCTGGAGGGATGGGGTGATGG + Intergenic
927001160 2:18795273-18795295 ACATTAGAGGGCTGTGGTAAAGG - Intergenic
927138579 2:20114693-20114715 GCACTGGGGAGCTGGGGTGGAGG - Intergenic
927211579 2:20642205-20642227 CCACTGGAGTGCTGGCGTGCAGG + Intronic
927265700 2:21147864-21147886 ACACTGTAGAGCTGGAGTAAAGG + Intergenic
927473398 2:23393810-23393832 ACACAGGAGGTTTGGGGTGTGGG + Intronic
927558833 2:24054379-24054401 CCATTTGAGGGGTGGGGTGATGG + Intronic
929451710 2:42042421-42042443 TCACTGGAGAGAAGGGGTGAGGG - Intergenic
929453588 2:42051653-42051675 ACCCTGGTGGGGTGGGGGGAAGG - Intronic
929579672 2:43073983-43074005 ACACTGGGGGGCTGGGGTGGAGG - Intergenic
929893132 2:45935910-45935932 ACACTGGAGTCCTGGAGTGCAGG + Intronic
931069920 2:58635020-58635042 AGACTGGCGGGTTGGGGTGGGGG - Intergenic
931450586 2:62364626-62364648 AAACTGCTGGGCTGGGGTCAGGG + Intergenic
931560867 2:63559524-63559546 ACACTTTTGGGCTGAGGTGAAGG - Intronic
931567687 2:63632128-63632150 GCACTGGAAGAATGGGGTGATGG - Intronic
931645430 2:64417535-64417557 AAACTGGGGGGCTAGGGTGGGGG + Intergenic
932131736 2:69193835-69193857 GCACTGCAAGGATGGGGTGAGGG + Intronic
933685412 2:85137322-85137344 AGAGTGGAGGGCAAGGGTGATGG - Intronic
933987110 2:87601345-87601367 AACCTGGAGGGCTGGGGCTAGGG - Intergenic
934567748 2:95349907-95349929 ACCCTGTAGGGCTGGGCTGGGGG + Intronic
934574912 2:95393886-95393908 ACTCTGAAGGGCAGTGGTGAAGG + Intergenic
934681497 2:96287015-96287037 CCACTGGAAGTCTGGCGTGATGG + Exonic
934851861 2:97706909-97706931 GCACTGGGGGGCTGGGGGGAGGG + Intergenic
935132126 2:100268658-100268680 ACACTGGGGGGAAGGGGAGATGG - Intergenic
935664502 2:105498361-105498383 GCACAGGAAGGCAGGGGTGAAGG + Intergenic
936049967 2:109215247-109215269 AAACTGGAGGGTAGGGGAGAAGG + Intronic
936306732 2:111349463-111349485 AACCTGGAGGGCTGGGGCTAGGG + Intergenic
936502444 2:113077033-113077055 ACAGTAGAAGGCTGGGGTGGGGG + Intergenic
936519852 2:113204848-113204870 GGACTGGAGGGTCGGGGTGAGGG + Intronic
936522544 2:113220222-113220244 TCAATGCAGGGCTGGGGTGTGGG + Intronic
936730339 2:115374822-115374844 AAACTGGAGTGCTGGGATGTAGG + Intronic
937013124 2:118579585-118579607 ACACTGGAGAGTTTGGTTGAAGG + Intergenic
937696108 2:124810431-124810453 ACAGTGGAGGGCAGGGGGAAAGG + Intronic
937913718 2:127088761-127088783 ACACTGAAGGGCTGGGGGTGAGG + Intronic
938369002 2:130756858-130756880 TCATGGGAGGGCTGGAGTGAGGG - Intronic
938710275 2:133970711-133970733 ACCCAGGAGGTCTGGGGTGGGGG - Intergenic
939777420 2:146404140-146404162 ACACTGCAGTGGTGGGCTGAAGG + Intergenic
940223110 2:151374550-151374572 TCACTGAAAGGCTGGGGTGTGGG - Intronic
940719529 2:157266972-157266994 TCACTGCAGGGCTGTGGTTATGG - Intronic
941412291 2:165174194-165174216 ACACTGGAGGCCAGGCATGATGG - Intronic
942458492 2:176153295-176153317 ACCCTGGAGGGGTGGAGTGGGGG - Intronic
943276269 2:185870457-185870479 ACAGTGGTGGGGTGGGGAGAGGG + Intergenic
944017959 2:195067670-195067692 ACAGTGGTGGGGTGGGGGGAGGG - Intergenic
944894074 2:204146045-204146067 ACAGGGAAGGGCTGGGGAGAAGG - Intergenic
946162086 2:217841503-217841525 ACACTGGAGGGAGGTGGGGAAGG + Intronic
946186031 2:217980859-217980881 ACGATGGGGTGCTGGGGTGAGGG - Intronic
946196512 2:218035525-218035547 ACAGTGGAGGGAAGGGGAGAGGG - Intronic
946200791 2:218069689-218069711 ACAGTGGAGGGAAGGGGAGAGGG - Intronic
946239613 2:218345568-218345590 ACACTGAAGGGCTGGAATGCTGG + Exonic
947618204 2:231572017-231572039 TGACTGGAGGGCTGGGGCGGTGG + Intergenic
948266390 2:236638154-236638176 ACACTGGAGAACTGGGGTCAGGG - Intergenic
948349566 2:237327482-237327504 GAACTGGAGGGCTAGGGTGGAGG - Intronic
948378506 2:237537814-237537836 ACACTGGAGGGCTGGGAGGGAGG - Intronic
1169768485 20:9175270-9175292 ACACTAGGGTGCTGGGGAGAAGG + Intronic
1170064688 20:12298800-12298822 GCAGTGGAGGGCTGGGGTTTGGG + Intergenic
1170404729 20:16024017-16024039 TCAGAGGTGGGCTGGGGTGATGG + Intronic
1171449104 20:25223865-25223887 ACACTGCAGGGTTGGGTTGTGGG + Intronic
1172099262 20:32475554-32475576 CCCCTGGAGGGCTGGGTTGAAGG - Intronic
1172508742 20:35484507-35484529 AAACTGGAGGGATGTGGAGAGGG - Intronic
1172838178 20:37886390-37886412 GCACTGCAGGGCAGGGGAGAGGG - Intergenic
1172847538 20:37938782-37938804 GCCCTGGAGGGCTGGGCTGAAGG + Intronic
1172896237 20:38302193-38302215 AAAAGGGAGAGCTGGGGTGAGGG + Intronic
1172970642 20:38870841-38870863 AAACTGGAGGGCTGGAGGGTTGG + Intronic
1172975545 20:38903250-38903272 ACACATGAAGCCTGGGGTGAAGG - Intronic
1173494880 20:43511448-43511470 ATAGTGGTGGGATGGGGTGAGGG + Intronic
1173505778 20:43585992-43586014 ACATTGCAGGGCTGGTCTGATGG - Intronic
1173581016 20:44146532-44146554 ACAAAGGAGGGATGTGGTGAAGG + Intronic
1173640204 20:44596418-44596440 AGACTGGAGGTGTGGGGGGAGGG + Intronic
1174117464 20:48236874-48236896 ACTCTGATGGGCTGGGGGGATGG + Intergenic
1175553534 20:59831990-59832012 ACACTGTGGGGCAGGGGTGGTGG + Intronic
1175759362 20:61550529-61550551 ATACTGGAGGGGTGGGTAGATGG - Intronic
1175852121 20:62099285-62099307 CCACGGAAGGGCTGGGTTGAGGG - Intergenic
1176114016 20:63423267-63423289 ACACTGCGGGGCTTGGGTGCGGG - Intronic
1176128730 20:63487378-63487400 AGAGTGGAGGGGTGGGGAGAGGG - Intergenic
1176173335 20:63706311-63706333 GCACTGGAGGGCTGGGGTGGGGG + Intronic
1177031463 21:15985081-15985103 TCTCTGGAGGGCAGGGGTGGGGG + Intergenic
1178627105 21:34227388-34227410 ACAAAGGTGGGCTGGGGCGACGG + Intergenic
1178915980 21:36705748-36705770 TCCATGGAGGGCTGGGGTTAGGG + Intronic
1179044980 21:37835824-37835846 ACACTGGAGGGTTAGGGTTAGGG - Intronic
1179597467 21:42452445-42452467 CAACTGGTGGGCTGGGGTGAGGG - Intergenic
1179787509 21:43738104-43738126 ACACTGAGGTGCTGGGGTTAAGG - Intronic
1179805789 21:43836062-43836084 ATCCTGTGGGGCTGGGGTGAGGG - Intergenic
1179972069 21:44841576-44841598 AAAGTAAAGGGCTGGGGTGAGGG + Intergenic
1180191781 21:46168803-46168825 ACACTTGAGGCCTGAGGGGAAGG - Intronic
1180398173 22:12378000-12378022 ACTCTGGTGGGGTGGGGAGATGG + Intergenic
1180841835 22:18962501-18962523 GCAGTGGAGGCCTAGGGTGAGGG + Intergenic
1181059669 22:20276363-20276385 GCAGTGGAGGCCTAGGGTGAGGG - Intronic
1181398970 22:22639730-22639752 ACACTGGTGGGCTGGGGACCTGG + Intergenic
1181602739 22:23961739-23961761 TGACTGGAAGGCTGGGGTTAAGG + Intergenic
1181605775 22:23979568-23979590 TGACTGGAAGGCTGGGGTTAAGG - Intronic
1181650449 22:24256329-24256351 ACACTGGTGGGCTGGGGACCTGG - Intergenic
1181706930 22:24654409-24654431 ACACTGGTGGGCTGGGGACCTGG + Intergenic
1181735324 22:24877015-24877037 ACACTAAAGGGCCTGGGTGATGG + Intronic
1182483758 22:30626923-30626945 AGAGTGGAGAGCTGGGGTCAGGG - Exonic
1182583502 22:31329141-31329163 ACTCTGCAAGGCTGCGGTGAGGG + Intronic
1182846970 22:33439391-33439413 AGACAGCAGGGATGGGGTGAGGG - Intronic
1183019017 22:35012474-35012496 ACACTGGGTGTCTGGGGTCATGG + Intergenic
1183019637 22:35016889-35016911 GCACTGGGGGTCTGGGATGAAGG - Intergenic
1183406164 22:37631696-37631718 TGCCTGGAGTGCTGGGGTGAGGG - Intronic
1183429032 22:37754774-37754796 ACACAGGAGGGGTGGGGAGGCGG - Intronic
1183601830 22:38844285-38844307 GCACGGGAGGGCTGGGATGGGGG - Intergenic
1183675186 22:39295136-39295158 GCACTGCTGGGCTGGGGTGGTGG + Intergenic
1183720773 22:39560192-39560214 ACACTTGGGGTGTGGGGTGAAGG - Intergenic
1183947581 22:41335433-41335455 AGCCTGGCAGGCTGGGGTGATGG + Intronic
1184069286 22:42138203-42138225 ACAGTGCAGCGCTGGGCTGAAGG - Intergenic
1184464013 22:44658610-44658632 ACACTGGAGGGGTGGGGGGCAGG + Intergenic
1184667775 22:45997681-45997703 ACAGCGGAGGGCGGGGGTTAGGG - Intergenic
950465808 3:13153108-13153130 ACACTGGAGGGGAGAGGAGAGGG - Intergenic
952931063 3:38361468-38361490 ACACTGGAGAATTGGGGTAAAGG + Intronic
953027191 3:39152136-39152158 ACAGGGTACGGCTGGGGTGAAGG + Intronic
953878269 3:46678674-46678696 CCACTGAGGGGCTGGGGTGGGGG + Intronic
954082681 3:48221796-48221818 AGTGTGCAGGGCTGGGGTGAGGG + Intergenic
954420236 3:50415073-50415095 ACACTGGGTGGCTGTGGAGATGG - Intronic
954532761 3:51335011-51335033 ACACTGGGAGGCTGGTGTGTAGG - Intronic
954655619 3:52192433-52192455 AGGCTGGAGGGCTGGGTTCAGGG + Intergenic
955593266 3:60560543-60560565 TCACTGCAGACCTGGGGTGAGGG - Intronic
955907857 3:63826436-63826458 ACAGTGAAGGGTTGGGGAGAGGG + Intronic
956424749 3:69122236-69122258 CCACGGGAAGGCTGGGGTCAGGG + Exonic
956880946 3:73510027-73510049 ACACTGGAGGTTGGGGGTGGAGG + Intronic
957371416 3:79300132-79300154 ACACTGCAGCGGTGGGCTGAGGG - Intronic
957446073 3:80314415-80314437 ACAGTGCAGGGGTGGGCTGAGGG - Intergenic
957955144 3:87176826-87176848 AGACTGGATGGCTGGGATGAGGG + Intergenic
958989854 3:100830266-100830288 TCACTGGAGGGTGGAGGTGAAGG - Intronic
959749054 3:109811673-109811695 ACACCGCAGGGCTGGTGTGGTGG + Intergenic
962691463 3:137902857-137902879 ACACAGGAAGGGTGGGGAGAGGG + Intergenic
963300086 3:143587656-143587678 GCACTGGAGGGTTGGGGTAGAGG + Intronic
965576443 3:170222627-170222649 ACGCTGGAGGCCGGGGGTGCGGG - Exonic
966560062 3:181310066-181310088 TCACTGGGGGGGTGGGGAGAGGG - Intergenic
967180238 3:186896966-186896988 ACACTGGAGGGCTGTGCTCTGGG + Intergenic
968736611 4:2300557-2300579 CCACTGGAGTCCTGGCGTGAGGG - Intronic
969224909 4:5789450-5789472 ACACTGGAGTGCTGGGGGTGAGG - Intronic
969286471 4:6205441-6205463 CCACTGCAGGGCTGGGCTGCTGG + Intergenic
970276129 4:14403169-14403191 AAAGGGGAGGGTTGGGGTGAGGG + Intergenic
971539998 4:27804083-27804105 AAACTGGTTGGCTGGGGTGGGGG - Intergenic
974012777 4:56622946-56622968 GGGCTGGAGGGCTGGGGTTAGGG + Intergenic
974670904 4:65028584-65028606 GCATAGGAAGGCTGGGGTGAAGG + Intergenic
975409414 4:74032027-74032049 AGACTGGAAGGATGGGGAGATGG - Intergenic
976501620 4:85796987-85797009 ACACTGGAGGGGCTGGGTGCTGG + Intronic
976629270 4:87220306-87220328 CGACTTGGGGGCTGGGGTGAGGG + Intronic
976659905 4:87529842-87529864 ACAGTGGAGAGCTGTGTTGAGGG - Intronic
978254950 4:106681902-106681924 ACAGTGCAGGGGTGGGCTGAAGG + Intergenic
978854725 4:113381481-113381503 ACAGAAGAGGGCTGTGGTGAAGG + Exonic
980103655 4:128566411-128566433 GCAGTGGATGGCTGGGGTGAGGG + Intergenic
980126129 4:128776039-128776061 ACTGTGAATGGCTGGGGTGAAGG + Intergenic
981000423 4:139823949-139823971 AGCCTGAAGGGTTGGGGTGAGGG - Intronic
981247667 4:142558692-142558714 AAACTGGAGGCCTGGGTTAAAGG + Intronic
981544386 4:145879265-145879287 ACCCTATAGGGCTGTGGTGAAGG + Intronic
983531807 4:168817560-168817582 ACTCTGGAGAGTTGGGGAGATGG - Intronic
983938830 4:173521705-173521727 TCCCTGGAGGGCTGGGGGAAGGG + Intergenic
984531142 4:180917567-180917589 ACACAGGAGGGGAGGGGTGATGG - Intergenic
985483017 5:129406-129428 AGTTTGGAGGGCAGGGGTGATGG - Intergenic
986479790 5:8175107-8175129 GCACTGCAGGGCTGGAATGATGG + Intergenic
987269020 5:16285934-16285956 AATCTGGAGCTCTGGGGTGATGG - Intergenic
988073422 5:26324334-26324356 ACAGTGCAGTGGTGGGGTGAAGG - Intergenic
988558673 5:32260718-32260740 GCACTGCAGGGCGGGGGGGAGGG + Intronic
989835393 5:45982219-45982241 ACAGTTGTGGGGTGGGGTGAGGG + Intergenic
990000257 5:50884209-50884231 ACAATGCACGGGTGGGGTGAGGG - Intergenic
990143049 5:52727852-52727874 ACACTGAAGGGCTGTGGGAAAGG + Intergenic
990285380 5:54296567-54296589 ACAGTGCAGGGCTGGGTTGCAGG - Intronic
991430867 5:66543633-66543655 AGACTGGGGAGCTGGGGGGATGG - Intergenic
992610550 5:78504798-78504820 CCTCTGCAGGGCTGGGGTGAAGG - Intronic
992906885 5:81355821-81355843 ACCTTGGATGGCTGGAGTGAAGG + Intronic
993633629 5:90317892-90317914 ACACTGAAGTGCTGGGATAATGG - Intergenic
994177852 5:96731650-96731672 ACTGTGGAGGGGTGGGGAGAGGG - Intronic
995336171 5:111002211-111002233 ACCCTTGAGAGCTGGGATGAGGG + Intergenic
997598394 5:135122487-135122509 ACACAGGATGTCTGGGGTGCAGG - Intronic
997901932 5:137774712-137774734 ACACTGGAGGCCGGGTGTGGTGG + Intergenic
997984728 5:138492938-138492960 AAGCTGGAGGGGTAGGGTGAGGG + Intergenic
998160399 5:139809731-139809753 GCCCTGGAGGGCTGGCGTGCTGG + Exonic
998452264 5:142244233-142244255 GCACAGGGGGGCTGGGGAGATGG - Intergenic
999326806 5:150649083-150649105 AAACTGGGGGGCTGGGGAGCCGG - Exonic
999976445 5:156916437-156916459 ATTCTGGAGGTATGGGGTGAAGG + Intergenic
1000519773 5:162280929-162280951 TCTCTGGAGGGCTGGAGTGGGGG + Intergenic
1000635939 5:163643784-163643806 CCATAGGAGGACTGGGGTGAAGG + Intergenic
1000865206 5:166505133-166505155 ACATTGGAGAGCAGAGGTGAAGG + Intergenic
1001359335 5:171065293-171065315 AGAATGGGGGGGTGGGGTGAAGG + Intronic
1001734687 5:173988866-173988888 ACCCAGTAGGGATGGGGTGACGG - Intronic
1002389705 5:178900381-178900403 ACACTGGCTGGCTGGGGTGGGGG - Intronic
1002389717 5:178900428-178900450 ACACTGGCTGGCTGGGGTGGGGG - Intronic
1002389740 5:178900522-178900544 ACACTGGCTGGCTGGGGTGGGGG - Intronic
1002389763 5:178900616-178900638 ACACTGTCTGGCTGGGGTGGGGG - Intronic
1002389776 5:178900663-178900685 ACACTGTCTGGCTGGGGTGGGGG - Intronic
1002389787 5:178900710-178900732 ACACTGTCTGGCTGGGGTGGGGG - Intronic
1002389808 5:178900804-178900826 ACACTGTCTGGCTGGGGTGGGGG - Intronic
1002478018 5:179480463-179480485 AGGCAGGAGGGCTGGGGTTAGGG - Intergenic
1002560082 5:180075484-180075506 CCACTGGAGTTCTGGGGAGAAGG - Intergenic
1002634532 5:180600567-180600589 AGAGTGAAGGGCTGGGGTGGAGG + Intergenic
1002882430 6:1264762-1264784 ACTTTGGAAGGCTGAGGTGATGG + Intergenic
1003713962 6:8625292-8625314 AAACTGGAGGAGTGGGGGGAGGG - Intergenic
1004039335 6:11960432-11960454 AGTCTGGAGTGCTGGGGAGAGGG - Intergenic
1004250249 6:14017948-14017970 ACAGTGGAGCGGTGGGCTGAAGG - Intergenic
1005363312 6:25053265-25053287 AAACTGGAGTGCAGGGGTGCTGG + Intergenic
1005481750 6:26261560-26261582 AGACAGGAGGGGTGGGGAGAAGG - Intergenic
1006158730 6:32029330-32029352 AGACTGGAGGTGAGGGGTGAGGG + Exonic
1006383943 6:33718447-33718469 ACACTGGAGGGATGGGGTGGCGG + Intergenic
1006808322 6:36803322-36803344 ACACAGGAGGGGTGGGGAGTTGG - Intronic
1006905858 6:37533037-37533059 ACACTGGAGTGATGGGGTAGGGG + Intergenic
1007417501 6:41700631-41700653 AGACTGCAGGGCTGGGGGCAGGG + Intronic
1007763811 6:44149706-44149728 CATCCGGAGGGCTGGGGTGAGGG - Intronic
1007775356 6:44221912-44221934 AAACTGGAGGGAAGTGGTGAGGG - Intronic
1007866714 6:44978746-44978768 ACATGGGAGGACTAGGGTGAGGG + Intronic
1007964971 6:45995959-45995981 ACTGTTGAGGGCTGGGGTGGGGG + Intronic
1008781278 6:55108816-55108838 GAACTGGGGGGTTGGGGTGAAGG + Intronic
1008932315 6:56954224-56954246 AGACTGGAGGGCGGAGGTGACGG + Intronic
1010235716 6:73572983-73573005 ACAGTGCAGCGCTGGGCTGAAGG + Intergenic
1011825797 6:91303577-91303599 ACAGTGCAGGGGTGGGCTGAAGG + Intergenic
1013113172 6:107080243-107080265 CCACTGGGAGGCTGAGGTGAGGG + Intronic
1013177631 6:107690908-107690930 GCATGGGAGGGGTGGGGTGAGGG + Intergenic
1015313107 6:131786550-131786572 ATACTTGAGGGCTGGGGTGATGG - Intergenic
1015667935 6:135652495-135652517 ACGGTGGGGGGCTGGGGGGAGGG - Intergenic
1016915171 6:149237942-149237964 ACACTGTGGGGCTGGGGAGCAGG - Intronic
1019486773 7:1293035-1293057 GCACTGGGGGGCGGGGGTGGAGG + Intergenic
1019516361 7:1441914-1441936 ACGCTGCAGGGCTGGGCTGCAGG + Intronic
1019541641 7:1554386-1554408 GCTGTGGAGGGCTGGGCTGAGGG - Intronic
1019578505 7:1749027-1749049 TCAATGGAGGGGTGGGGTGGGGG - Intergenic
1019609759 7:1930531-1930553 ACGGTGGTGGGATGGGGTGAGGG - Intronic
1020080360 7:5283192-5283214 ACAGGGGCGGGCTGGGGAGAGGG - Intronic
1021597307 7:22331013-22331035 ACAGTGGAGGGCTGTGGGGCAGG - Intronic
1021775790 7:24054106-24054128 ACACTGAAAGACTGGGGTCAGGG - Intergenic
1022315362 7:29240304-29240326 ACACTGGAGGGAAGGGGTGAAGG - Intronic
1022388834 7:29926338-29926360 ACACTGGATGGGTGGGGGTAGGG + Intronic
1022691069 7:32655436-32655458 ATACTTGAGGGCAGGCGTGATGG + Intergenic
1023043311 7:36191379-36191401 ACACTGGAGAGGTGGGAAGAGGG + Intronic
1023127881 7:36973657-36973679 ACACTGCAGCGGTGGGCTGAAGG - Intronic
1023608016 7:41947179-41947201 ACATGGAAGGGTTGGGGTGAGGG + Intergenic
1023913828 7:44573811-44573833 ACACGCGAGGGCTGGGGAGCCGG - Intronic
1024204547 7:47145738-47145760 ACACAGGAGGGGTGGGGAGTGGG + Intergenic
1025078614 7:55964216-55964238 ACATTGGCGGGGTGGGGTGGGGG + Intronic
1025198555 7:56948987-56949009 ACAGGGGCGGGCTGGGGAGAGGG + Intergenic
1025256189 7:57385275-57385297 ACAATTGAGGGCTGGCGCGAGGG - Intergenic
1025673396 7:63627946-63627968 ACAGGGGCGGGCTGGGGAGAGGG - Intergenic
1026899158 7:74027647-74027669 AGTCTGGAGGGCCGGGGTGGGGG + Intergenic
1027158935 7:75788363-75788385 TCTCTGGCGGGCAGGGGTGAGGG - Intronic
1027162205 7:75811115-75811137 AACGTGGAGGACTGGGGTGAAGG - Intergenic
1027408534 7:77888498-77888520 ACACTGGAGGCATTGGGGGAGGG + Intronic
1027778896 7:82499526-82499548 ACAGTGCAGGGGTGGGCTGAAGG - Intergenic
1031224754 7:119021647-119021669 GCACTGGAGGACTGGATTGATGG + Intergenic
1031598298 7:123672761-123672783 ACACTGGAGGAGTGGTGAGAGGG - Intergenic
1032166807 7:129551749-129551771 AAACTGGAGGGGTTGGGGGAGGG + Intergenic
1032370852 7:131350302-131350324 ACTCTGGGAGGCTGAGGTGAAGG - Intronic
1032468871 7:132163968-132163990 ACAGAGGAAGTCTGGGGTGATGG + Intronic
1034261750 7:149761170-149761192 CCACTGGAGGCCTGTGGTGATGG - Intergenic
1034678623 7:152910926-152910948 CCTGTGGAGGGCTGGGGAGAGGG - Intergenic
1036974386 8:13394698-13394720 AGACTGGAGAGTTGGGGTGCGGG - Intronic
1037324476 8:17674543-17674565 AAACTGGAGGGCTGGGTGGTGGG + Intronic
1037709222 8:21342343-21342365 ACACTGGAGGGATGGAGGGGTGG + Intergenic
1038438948 8:27558451-27558473 AGGCTGGAAGGCTGGGATGAAGG + Intergenic
1039105354 8:33983688-33983710 ACACCGTAGGGCTGGGTGGATGG - Intergenic
1039922833 8:41905315-41905337 ACAGTGGAGGGCCCGGGGGAGGG - Intergenic
1039987756 8:42462161-42462183 AGACAGGAGGGGAGGGGTGAAGG + Intronic
1040495888 8:47965358-47965380 ACTCTGGGAGGCTGAGGTGACGG + Intronic
1043420137 8:80089255-80089277 CAACTGGAGGACTTGGGTGACGG + Intronic
1043874060 8:85464550-85464572 AAGCTGGAGGGGTGGGGTGGGGG - Intronic
1044569449 8:93700708-93700730 ACACTGGAGGGCTGGGGTGAGGG + Intronic
1044949061 8:97418088-97418110 ACTCTGGAAGGCTGAGGTGGTGG - Intergenic
1046675115 8:117099411-117099433 AGACTGGAGGGCTTGGGTTCTGG - Intronic
1047593235 8:126349532-126349554 ACACTGCACAGCTTGGGTGATGG + Intergenic
1048415518 8:134224016-134224038 ACACTGGAGGTAAAGGGTGATGG - Intergenic
1048511608 8:135067526-135067548 CCACTGCAGGGGTGGGGTGAAGG - Intergenic
1048848888 8:138625363-138625385 ACAGTGGAGGGCAGGGTTGGGGG + Intronic
1049289810 8:141795821-141795843 ACCCTGCAGGCCTGGGGTGGGGG + Intergenic
1049432644 8:142572357-142572379 CACCTGGAGAGCTGGGGTGAGGG - Intergenic
1049564357 8:143330550-143330572 CCACGGGAGGGCTGGTGGGAGGG + Intronic
1049800620 8:144515929-144515951 ATACGGGAGGGCTGAGGGGAGGG + Intronic
1049802378 8:144523956-144523978 ACACTGGAGGGCTGCGGGAGTGG - Exonic
1053231245 9:36411811-36411833 ACCTTGGAGGGCTGAGGTGGTGG - Intronic
1055113402 9:72582381-72582403 ATTCTGGTGGGCTGGGGGGAAGG - Intronic
1056474600 9:86941690-86941712 ACATTGCTGGGATGGGGTGAGGG + Intergenic
1057181004 9:93030370-93030392 CCACTGGAGCGCTGGGGCAAAGG - Intronic
1057279767 9:93701249-93701271 CCCCAGGAGGGTTGGGGTGAGGG + Intergenic
1057459779 9:95250762-95250784 ACACTCCAGGGCTAGGCTGAGGG - Intronic
1057511068 9:95680244-95680266 ACAGTGCAGGGGTGGGCTGAAGG - Intergenic
1058253376 9:102730016-102730038 TCTCTGGTGGGCAGGGGTGAAGG + Intergenic
1058716534 9:107727381-107727403 ACAATGGAGGACTGGAGTGGGGG - Intergenic
1058743432 9:107966697-107966719 ACAGAGGAGGGCTGGGCAGAGGG + Intergenic
1058932647 9:109736741-109736763 AGAGTGGAAGGTTGGGGTGAGGG - Intronic
1060479762 9:124011402-124011424 AGGCTGGAGGGCGGGGGTGGGGG - Intronic
1061824920 9:133252180-133252202 GCCCAGGAGGGCTGGGGAGAGGG - Intronic
1061917988 9:133766605-133766627 ACACTGGAGGGGGAGGGGGAGGG + Intronic
1062034244 9:134375714-134375736 AAGCCTGAGGGCTGGGGTGAGGG + Intronic
1062307967 9:135920289-135920311 ACAATGGGGGGCTGGGGTTGGGG + Intergenic
1062382410 9:136292822-136292844 ACACGGGTGGGCAGCGGTGAAGG + Intronic
1062474035 9:136718864-136718886 GCAGTGGAGGACTGGGGTGTGGG + Intronic
1062481564 9:136754877-136754899 ACCCTGGGAGGCTGGGGTCACGG - Intronic
1062617970 9:137406770-137406792 CCAGAGGAGGGCTGGGGAGAGGG - Intronic
1203379386 Un_KI270435v1:16691-16713 ACTCTGGTGGGGTGGGGAGATGG + Intergenic
1185893986 X:3842919-3842941 ACACTGGGAGGCTGGCCTGAGGG + Intronic
1185899103 X:3881343-3881365 ACACTGGGAGGCTGGCCTGAGGG + Intergenic
1185904220 X:3919772-3919794 ACACTGGGAGGCTGGCCTGAGGG + Intergenic
1186350196 X:8732201-8732223 GCCCTCGAGGGGTGGGGTGAGGG + Intergenic
1186681815 X:11882861-11882883 AGACTGGAGGGATGAGGTAATGG + Intergenic
1187247451 X:17565599-17565621 CCACTGCAAGGCTGGTGTGAAGG - Intronic
1187485598 X:19700063-19700085 ACACTGGAGGGGTGGGTTTGAGG + Intronic
1190059311 X:47200825-47200847 AAAATGGAGGGCTGGTGTGGAGG - Intronic
1192659962 X:73031831-73031853 ACAGTTGTGGGGTGGGGTGAAGG - Intergenic
1192974943 X:76273263-76273285 ACTGTGGTGGGGTGGGGTGAGGG + Intergenic
1193040259 X:76997090-76997112 ACACTGCAGTGGTGGGCTGAAGG + Intergenic
1193383145 X:80840364-80840386 ACTCTGGAGACTTGGGGTGAAGG + Intergenic
1194597249 X:95873597-95873619 ACACTGGAGGTGTGGGTTGAGGG + Intergenic
1195099322 X:101539298-101539320 ACGCTGGAGGCCGGGGGTGCGGG + Intergenic
1195249853 X:103032324-103032346 GGACTAGAGGGCTGGGGGGAGGG + Intergenic
1196829464 X:119764896-119764918 ACTCTGGGAGGCTGAGGTGAGGG + Intergenic
1196871941 X:120120795-120120817 ACACTGGAGGCCTGAGTTTATGG - Intergenic
1197077658 X:122372800-122372822 ACACTGGAGGCCAGGCATGATGG + Intergenic
1197862847 X:130988450-130988472 ACACTGGGGAGTTGGGGTGTGGG + Intergenic
1198499915 X:137233637-137233659 TCACTGGACGGCTGGAGGGAGGG - Intergenic
1198504033 X:137283103-137283125 ACACTTCAAGGCTGGTGTGATGG + Intergenic
1199086618 X:143635579-143635601 ACACTGGAGAGCCTGGGGGAGGG + Intronic
1199337453 X:146636321-146636343 ACAATCTAGGGCTGGGGTGCTGG + Intergenic
1199600894 X:149540512-149540534 ACAATTGGGGGCTGGGTTGAGGG - Intronic
1199669520 X:150131556-150131578 ACTGTGGAGGGGTGGGGGGAGGG - Intergenic
1199717474 X:150516729-150516751 ATGCTGGAGTGCTGGGGTGCTGG - Intergenic
1200135595 X:153873136-153873158 ACTCAGGAGGGCGGGGGTGCAGG + Intronic
1200243665 X:154511394-154511416 ACACTGCCGGCCTGGAGTGAAGG + Intronic
1200519764 Y:4195898-4195920 ACAGTGCAGTGGTGGGGTGAAGG + Intergenic
1200874060 Y:8134464-8134486 ACTGTGGTGGGCTGGGGGGAGGG - Intergenic
1201767476 Y:17585838-17585860 ACACAGATGGGCTGGGGGGAGGG - Intergenic
1201834077 Y:18320147-18320169 ACACAGATGGGCTGGGGGGAGGG + Intergenic