ID: 1044569450

View in Genome Browser
Species Human (GRCh38)
Location 8:93700714-93700736
Sequence GAGGGCTGGGGTGAGGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3127
Summary {0: 1, 1: 2, 2: 27, 3: 317, 4: 2780}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044569429_1044569450 29 Left 1044569429 8:93700662-93700684 CCTGGAAAACCGGTAACAGCCCG 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1044569450 8:93700714-93700736 GAGGGCTGGGGTGAGGGAAGTGG 0: 1
1: 2
2: 27
3: 317
4: 2780
1044569428_1044569450 30 Left 1044569428 8:93700661-93700683 CCCTGGAAAACCGGTAACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1044569450 8:93700714-93700736 GAGGGCTGGGGTGAGGGAAGTGG 0: 1
1: 2
2: 27
3: 317
4: 2780
1044569433_1044569450 10 Left 1044569433 8:93700681-93700703 CCCGAGCCCAGCTGCCCAGGGCC 0: 1
1: 5
2: 16
3: 75
4: 777
Right 1044569450 8:93700714-93700736 GAGGGCTGGGGTGAGGGAAGTGG 0: 1
1: 2
2: 27
3: 317
4: 2780
1044569435_1044569450 4 Left 1044569435 8:93700687-93700709 CCCAGCTGCCCAGGGCCGCCCAC 0: 1
1: 0
2: 0
3: 42
4: 376
Right 1044569450 8:93700714-93700736 GAGGGCTGGGGTGAGGGAAGTGG 0: 1
1: 2
2: 27
3: 317
4: 2780
1044569438_1044569450 -4 Left 1044569438 8:93700695-93700717 CCCAGGGCCGCCCACACTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 175
Right 1044569450 8:93700714-93700736 GAGGGCTGGGGTGAGGGAAGTGG 0: 1
1: 2
2: 27
3: 317
4: 2780
1044569434_1044569450 9 Left 1044569434 8:93700682-93700704 CCGAGCCCAGCTGCCCAGGGCCG 0: 1
1: 0
2: 7
3: 59
4: 531
Right 1044569450 8:93700714-93700736 GAGGGCTGGGGTGAGGGAAGTGG 0: 1
1: 2
2: 27
3: 317
4: 2780
1044569440_1044569450 -5 Left 1044569440 8:93700696-93700718 CCAGGGCCGCCCACACTGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 541
Right 1044569450 8:93700714-93700736 GAGGGCTGGGGTGAGGGAAGTGG 0: 1
1: 2
2: 27
3: 317
4: 2780
1044569436_1044569450 3 Left 1044569436 8:93700688-93700710 CCAGCTGCCCAGGGCCGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 426
Right 1044569450 8:93700714-93700736 GAGGGCTGGGGTGAGGGAAGTGG 0: 1
1: 2
2: 27
3: 317
4: 2780
1044569430_1044569450 20 Left 1044569430 8:93700671-93700693 CCGGTAACAGCCCGAGCCCAGCT 0: 1
1: 0
2: 1
3: 2
4: 121
Right 1044569450 8:93700714-93700736 GAGGGCTGGGGTGAGGGAAGTGG 0: 1
1: 2
2: 27
3: 317
4: 2780

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044569450 Original CRISPR GAGGGCTGGGGTGAGGGAAG TGG Intronic
Too many off-targets to display for this crispr