ID: 1044571985

View in Genome Browser
Species Human (GRCh38)
Location 8:93730232-93730254
Sequence CTGCAAAAACAGAGGCAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 452}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044571985 Original CRISPR CTGCAAAAACAGAGGCAGCA AGG Exonic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901000227 1:6145370-6145392 CCTCAAAAACAGAGGCCACAGGG + Intronic
901153553 1:7120719-7120741 CTCCACAAAGGGAGGCAGCAAGG - Intronic
904299425 1:29544493-29544515 GGGCAGAAACAGAGGCTGCAAGG - Intergenic
904619159 1:31765109-31765131 CTACACAAACAGATGCAACATGG - Intergenic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905853229 1:41289773-41289795 TTTCAAAAACAGAAGCAACAGGG + Intergenic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
906243454 1:44256904-44256926 CTGCAGGGACTGAGGCAGCATGG - Intronic
906280476 1:44549950-44549972 CTCCAAAAAGTGAAGCAGCAAGG + Intronic
906306692 1:44724344-44724366 CTGCAAAAACATCGGCAGGCTGG - Exonic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
907074987 1:51570039-51570061 CTTGAAAATCAGAGGTAGCATGG - Intergenic
908886515 1:68795572-68795594 CTGAAAAAGCACAGACAGCATGG - Intergenic
909479293 1:76114228-76114250 CTGAAAAAATATAGACAGCATGG + Intronic
910190444 1:84589514-84589536 CTGGAAAAACCCAGGCAGCTAGG + Intergenic
912025822 1:105170287-105170309 ACGCAAAAACAGAGACAGTAAGG + Intergenic
913095925 1:115515116-115515138 GTCCAAAAAGAGAGTCAGCAAGG + Intergenic
913369640 1:118083794-118083816 AAACAAAAACAGAGACAGCAGGG + Intronic
915036486 1:152931139-152931161 CAGAAAAAACGGAGGAAGCATGG - Intergenic
915277917 1:154802392-154802414 TTGAAAAAACACAGGGAGCAGGG + Intronic
915575603 1:156774592-156774614 CTGCGGAGACTGAGGCAGCAGGG - Intronic
915972888 1:160366741-160366763 CTCCCACACCAGAGGCAGCAGGG - Intergenic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916194288 1:162209147-162209169 TTGCAAATACAGAGGCCCCATGG - Intronic
916315654 1:163445346-163445368 CTGCATAATGAGAGGCAGCCTGG + Intergenic
916389409 1:164314738-164314760 AAGCGAAAACAGAGGTAGCAGGG + Intergenic
916894724 1:169151042-169151064 CCGCACAAAAACAGGCAGCAAGG + Intronic
917855062 1:179093000-179093022 CTCCAAAAAGAGAGAAAGCACGG + Intronic
920454133 1:206085069-206085091 TTGAAGAAACTGAGGCAGCAAGG - Intronic
920493023 1:206433164-206433186 CTGCAAAAAGAAATGCAGGAAGG + Intronic
920680877 1:208071637-208071659 CAGCTAAGACAGAGCCAGCAAGG - Intronic
920738826 1:208560693-208560715 CTGCAAAAATAGAGGATGCCTGG - Intergenic
920930298 1:210381783-210381805 CTCCAAAAACAGTGGGACCAGGG + Intronic
924200392 1:241652376-241652398 GGGCAAAAACTGAGACAGCAGGG + Exonic
924472370 1:244353801-244353823 CTGAGAAAACAGAAGCAACAGGG + Intronic
1063005382 10:1965204-1965226 CTGCAAAAACACAGGATGGAAGG + Intergenic
1063148617 10:3318298-3318320 CTGCCCACACAGAGGCTGCAGGG - Intergenic
1063148689 10:3318571-3318593 CTGCCCACACAGAGGCTGCAGGG - Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065487605 10:26249877-26249899 CTGCCAGGACAGAGGCAGGAGGG + Intronic
1065498322 10:26352752-26352774 GTCCAAAAAGAGAGTCAGCAAGG - Intergenic
1065857893 10:29845110-29845132 GTGCAAAAGCAGAAGCTGCAAGG - Intergenic
1066525584 10:36275520-36275542 CTACAATAACAAAAGCAGCATGG + Intergenic
1066954492 10:42150901-42150923 CCGCAAAAACCGCGGCAGCGAGG + Intergenic
1067571376 10:47373824-47373846 CTGAATAAACGCAGGCAGCATGG + Intronic
1067966458 10:50918611-50918633 CTTCAAAAACATAGCCAGAAAGG - Intergenic
1068449331 10:57165556-57165578 CTGCAAAGACAGAGCCCTCATGG - Intergenic
1069042767 10:63712099-63712121 CAGGAAAAACACAGGCACCATGG - Intergenic
1069258662 10:66365814-66365836 GTGAAAAAATATAGGCAGCATGG + Intronic
1070004293 10:72408038-72408060 CTGCAAGAGGAGAGACAGCAAGG + Intronic
1070384993 10:75916383-75916405 CTGGCAAGAGAGAGGCAGCAGGG + Intronic
1070648601 10:78219059-78219081 AGGCAGAAACAAAGGCAGCAAGG - Intergenic
1072616162 10:97050002-97050024 CTGTACAAACCGAGGCAGCCTGG + Intronic
1074164421 10:110862410-110862432 CTTAAAAAGCAGAGGCCGCAGGG - Intergenic
1074173930 10:110976605-110976627 TTTCAAAAACGAAGGCAGCAAGG - Intronic
1074746799 10:116542578-116542600 CTGCAACACCAGAGGCAGATTGG - Intergenic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1076120412 10:127932579-127932601 CTGCAGCAACAGAGACAGGAGGG + Intronic
1077523116 11:3048002-3048024 CTGCAAAGACAGAGGGCACATGG + Intronic
1079080884 11:17412989-17413011 AAACAAAGACAGAGGCAGCAGGG + Intronic
1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG + Intergenic
1080188297 11:29518630-29518652 CTGCAAAACCAGAGCCCTCAAGG + Intergenic
1080189545 11:29527479-29527501 CTGCAAAACCAGAGCCCTCAAGG + Intergenic
1080402902 11:31953998-31954020 CAGCCAGGACAGAGGCAGCAAGG + Intronic
1081386636 11:42480305-42480327 CTGCAGAAACAGAGCCCTCATGG + Intergenic
1081518320 11:43856027-43856049 ATGCAGAAACAAAGGCAGCTGGG - Exonic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1083111908 11:60418734-60418756 CTACAAAGGCACAGGCAGCAAGG - Intergenic
1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG + Exonic
1083935121 11:65865963-65865985 CTGCAGGAAGAGAGGCAGCGAGG - Intronic
1084105716 11:66978968-66978990 CAGCGAAAACAGAAGCTGCAAGG - Intergenic
1084553209 11:69861304-69861326 CTGCCCAAAGGGAGGCAGCAAGG + Intergenic
1084709681 11:70836204-70836226 CTGCACACTCAGAAGCAGCATGG + Intronic
1084934903 11:72581591-72581613 CTGCTAAGACAGAGTCATCAAGG - Intronic
1085315487 11:75542368-75542390 CTGCTAAAACAGGGACAGAATGG - Intergenic
1085758992 11:79225632-79225654 CTACAAAAAAATAGCCAGCATGG - Intronic
1087678070 11:101185441-101185463 AAGCAAGACCAGAGGCAGCAAGG + Intergenic
1087919499 11:103849985-103850007 CTTCATAAACAGAAGCAGCAAGG - Intergenic
1088224313 11:107602988-107603010 CTCCCAGAACAGAGGCAGCCAGG - Intronic
1088325660 11:108598399-108598421 CTGGAAATGCAGAGGCACCAAGG + Intergenic
1088683968 11:112269534-112269556 CTGCAACAACAGAACCAACACGG - Intronic
1089097232 11:115929335-115929357 CTGCAAAGACAAAGACAGCTAGG - Intergenic
1090187778 11:124749533-124749555 CTGCAGAAAGACAGGCAGGAGGG + Intronic
1091398730 12:170308-170330 CTTCCAAAAGAGAGGCAGGAAGG - Intronic
1092193801 12:6537286-6537308 CTGCAAAGAAAGAGGGAGCGGGG - Intronic
1092496174 12:8997373-8997395 CTAGAACAACAGACGCAGCAGGG - Intronic
1092927319 12:13283078-13283100 CTGTGAAGACTGAGGCAGCAGGG + Intergenic
1094050350 12:26213633-26213655 TTGAAATAACAGAGCCAGCAAGG + Intronic
1094396931 12:30016999-30017021 CTGCGAGAAGAGAGGCAGAAAGG - Intergenic
1094715104 12:33005999-33006021 CTGCAGAAAGAGAGGCAGAGTGG - Intergenic
1095458026 12:42410728-42410750 ATGCAAAAACACAGCCAGCCAGG + Intronic
1097064377 12:56309997-56310019 CAGCAAGAACAGAGACAGGAAGG - Exonic
1098872321 12:75830542-75830564 CTACAGTAACAGAAGCAGCATGG + Intergenic
1099498093 12:83377511-83377533 GTCCAAAAAGAGAGTCAGCAAGG - Intergenic
1099982718 12:89625286-89625308 CCCCAAAAATAGAGGCAGCTGGG + Intronic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1101375456 12:104167495-104167517 CTGCAACACCAGAGGCAGACAGG + Intergenic
1101525590 12:105526018-105526040 CTCCACAAACAGAAGCAGAATGG - Intergenic
1101541249 12:105667458-105667480 TTGCAAAAACTGAGACAGCAGGG + Intergenic
1102143497 12:110636692-110636714 CCACAACAACAGAGGCAGCTGGG - Intronic
1102290397 12:111694506-111694528 CTCTAAAAAAAAAGGCAGCAGGG + Intronic
1102452859 12:113054736-113054758 CAACAAACACAGAGGCAGCATGG + Intergenic
1102462448 12:113108273-113108295 CTGCGTAAACTGAGGCAGCAAGG + Intronic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104509770 12:129366725-129366747 ATGCAAAGACAGGGCCAGCATGG + Intronic
1105350181 13:19607889-19607911 AGGCAAAAACAAAGGCAGAATGG - Intergenic
1105444363 13:20439903-20439925 CTGAGAAAACAGCGGAAGCAGGG + Intronic
1105582915 13:21717909-21717931 CTGCCAGAGCAGAGGCAGGAGGG - Intergenic
1106774754 13:32998269-32998291 CTGCTAAAAGAGTGGCAGCTGGG + Intergenic
1107408010 13:40133118-40133140 CTGTAAAATCAGTGACAGCATGG - Intergenic
1107695969 13:43000308-43000330 CTGAAAAAACAAAGTGAGCAGGG + Intergenic
1108267249 13:48724425-48724447 TGGCAAAGAAAGAGGCAGCAGGG - Intergenic
1108454796 13:50602201-50602223 CTGCAAAAACAGAGACTTTAAGG + Intronic
1109893407 13:68650249-68650271 CTGCAAAAACACAGGCACGCAGG + Intergenic
1109910374 13:68903505-68903527 CTGCAGAAACAAAAACAGCATGG - Intergenic
1110028764 13:70577644-70577666 CTCCAAAAACATAAGCAACAAGG + Intergenic
1110318860 13:74137185-74137207 CTGCAAACACAGAGGTAGAGAGG - Intergenic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1113289348 13:108887767-108887789 CTACAAAAACTAAGGCAGTAAGG - Intronic
1114059009 14:19001989-19002011 CTGCAAAGGCAGTGGCAGAAAGG - Intergenic
1114103534 14:19399765-19399787 CTGCAAAGGCAGTGGCAGAAAGG + Intergenic
1114370340 14:22079753-22079775 CTGCAGAAACAGAGTCACTAGGG - Intergenic
1115181043 14:30626103-30626125 CTGAAATAACACAGGAAGCACGG - Intronic
1115833344 14:37367521-37367543 CTGAAGAAAAAGAGGAAGCATGG - Intronic
1118622044 14:67622222-67622244 GTGCAAAATGTGAGGCAGCACGG + Intronic
1118780853 14:69006569-69006591 CTGCAAAGTTAGAGGCAGCCCGG + Intergenic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1122034321 14:98936406-98936428 CTGATAAAAGAGAGGCAGGAGGG + Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123138875 14:106055850-106055872 CTGCAAACACAGAGACATCCTGG + Intergenic
1123139642 14:106062456-106062478 CTGCAAACAAAGAGACACCAAGG + Intergenic
1123141953 14:106088429-106088451 CTGCAAACAAAGAGACACCAAGG + Intergenic
1123144667 14:106116942-106116964 CTGCAAACACAGAGACAACCTGG + Intergenic
1123149247 14:106165510-106165532 CTGCAAACACAGAGACACCCTGG + Intergenic
1123154519 14:106211243-106211265 CTGCAAACACAGAGACACCCTGG + Intergenic
1123162211 14:106289333-106289355 CTGCAAACACAGAGACACCCCGG + Intergenic
1123172724 14:106389697-106389719 CTGCAAACACAGAGACACCCTGG + Intergenic
1123173542 14:106396970-106396992 CTGCAAACACAGAGACATCCTGG + Intergenic
1123175285 14:106410795-106410817 CTGCAAACACAGAGACACCAAGG + Intergenic
1123180351 14:106463568-106463590 CTGCAAACACAGAGACACCCTGG + Intergenic
1123181070 14:106470572-106470594 CTGCAAACACAGAGACACCCTGG + Intergenic
1123186176 14:106518883-106518905 CTGCAAACACAGAGACACCAAGG + Intergenic
1123187959 14:106538117-106538139 CTGCAAACAAAGAGACACCAAGG + Intergenic
1123189716 14:106557249-106557271 CTGCAAACACAGAAACACCAAGG + Intergenic
1123192757 14:106586683-106586705 CTGCAAACACAGAGACACCCTGG + Intergenic
1123198978 14:106643437-106643459 CTGCAAACACAAAGACACCAAGG + Intergenic
1123200420 14:106658030-106658052 CTGCAAACACAGAGACACCAAGG + Intergenic
1123214153 14:106791005-106791027 CTGCAAACACAGAGACACCCTGG + Intergenic
1123215216 14:106803005-106803027 CTGCAAACACAGAGACACCCTGG + Intergenic
1123216129 14:106810747-106810769 CTGCAAACACAGAGACACCCTGG + Intergenic
1202943404 14_KI270726v1_random:4984-5006 CTGCAAACACAGAGACACCAAGG - Intergenic
1202945838 14_KI270726v1_random:26207-26229 CTGCAAACACAGAGACACCCTGG - Intergenic
1202946545 14_KI270726v1_random:33084-33106 CTGCAAACACAGAGACACCCTGG - Intergenic
1123401147 15:19987969-19987991 CTGCAAACACAGAGACACCCTGG + Intergenic
1124496235 15:30189090-30189112 CGGCAAAAGCAGAGCCAGCAGGG + Intergenic
1124747339 15:32349557-32349579 CGGCAAAAGCAGAGCCAGCAGGG - Intergenic
1127017799 15:54708311-54708333 CTCCAAGATCAGAGCCAGCATGG + Intergenic
1127625018 15:60771862-60771884 TTGGAAAAACATAGGTAGCACGG + Intronic
1128254224 15:66185251-66185273 CTGCAGAACTTGAGGCAGCAGGG - Intronic
1128314480 15:66652047-66652069 TTGCAAACACAGACCCAGCATGG + Intronic
1129618356 15:77119330-77119352 TTGCAAAAACAGAGGCTTGAAGG + Intronic
1129681664 15:77661759-77661781 CTGAGCAAACAGAGACAGCATGG + Intronic
1130387477 15:83424246-83424268 CCGCAAAGTCAGAGGAAGCATGG - Intergenic
1130964717 15:88688531-88688553 CTCCAAAAACCCAGGCAGCAAGG - Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1132142499 15:99407272-99407294 CTGCAAAGCCAGGTGCAGCAGGG + Intergenic
1132226111 15:100142655-100142677 GTTCAAGAACAGAGGCAGAATGG + Intronic
1132858202 16:2056954-2056976 TCCCAAAGACAGAGGCAGCAGGG - Intronic
1133361219 16:5175297-5175319 CTGCCAAAACAGGGACAGCACGG - Intergenic
1133598541 16:7316834-7316856 CTGGAAAAACAAAGGGACCAGGG + Intronic
1133771566 16:8869563-8869585 CTCCAAAAACAGAGGACTCAAGG - Intergenic
1134436759 16:14266538-14266560 CAGCAAATACAAAGGCATCATGG - Exonic
1135772333 16:25227045-25227067 CTGCAAACACCCAGGCACCAAGG - Intronic
1136680972 16:31962054-31962076 CTGCAAACACAGAGACATCCTGG - Intergenic
1136682076 16:31973698-31973720 CTGCAAACACAGAGACACTAAGG - Intergenic
1136781291 16:32903567-32903589 CTGCAAACACAGAGACATCCTGG - Intergenic
1136782387 16:32915200-32915222 CTGCAAACACAGAGACACTAAGG - Intergenic
1136795028 16:33009295-33009317 CTGCAAACACAGAGACAACCTGG - Intergenic
1136874884 16:33845087-33845109 CTGCAAACACAGAGACAACCTGG + Intronic
1136887406 16:33938651-33938673 CTGCAAACACAGAGACACTAAGG + Intergenic
1136888507 16:33950273-33950295 CTGCAAACACAGAGACATCCTGG + Intergenic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1137714688 16:50591582-50591604 CTGTACAAAAAGAGGAAGCATGG - Intronic
1137720789 16:50626195-50626217 ATGCAAAGACACAGGCAGGAAGG - Intronic
1138690920 16:58767891-58767913 CTTCGAAGACAGAGGCAACATGG - Intergenic
1141517596 16:84556424-84556446 CTGCAAAAAGAGAGGAGGGAGGG + Intergenic
1142141058 16:88473060-88473082 CTGCAGAAACGGAGGCTGCCCGG - Intronic
1142368778 16:89666123-89666145 CTGGAAAACCAGAGGCATGAGGG + Intronic
1203083946 16_KI270728v1_random:1167549-1167571 CTGCAAACACAGAGACATCCTGG - Intergenic
1203085047 16_KI270728v1_random:1179187-1179209 CTGCAAACACAGAGACACTAAGG - Intergenic
1143020586 17:3915448-3915470 GTGCAGAATCAGAGGCAGCGTGG - Intronic
1143618018 17:8064891-8064913 CTGCAGAAACAAAGACAGAATGG - Intergenic
1143889100 17:10088679-10088701 CTCCAGAAATAGAGACAGCATGG - Intronic
1144081576 17:11768430-11768452 CTGCAAAAACAAAGACAGTCAGG - Intronic
1144289448 17:13812474-13812496 TTGCAAAAACATAGGGAGAAAGG + Intergenic
1144809375 17:17988978-17989000 CTGCAAAAGCCTGGGCAGCAGGG - Intronic
1144857894 17:18280343-18280365 CTGCCAAAGCAGTGACAGCATGG + Intronic
1145816797 17:27800797-27800819 CTGCTAAGATAGAGGCACCACGG + Intronic
1146270053 17:31478993-31479015 ATGCAACAAGAGAGGCAGAAGGG + Intronic
1146533724 17:33632005-33632027 TTGCAGAAAAGGAGGCAGCATGG + Intronic
1147772428 17:42877249-42877271 CTACAAGACCTGAGGCAGCAGGG - Intergenic
1147898191 17:43765949-43765971 CTGCATAAACAGTGCCATCATGG + Intergenic
1148026740 17:44593915-44593937 CTGCAAACTCAGAGGCAAAAAGG - Intergenic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1148893662 17:50826954-50826976 CTGCAGAAATAAAGGCAACATGG - Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149294345 17:55248257-55248279 ATGCAAACACAATGGCAGCAGGG + Intergenic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1150508209 17:65720527-65720549 TGGTAAAGACAGAGGCAGCAAGG + Intronic
1151221547 17:72616460-72616482 CTGCAGAATTAGAGGCAGCCTGG - Intergenic
1151830807 17:76549033-76549055 ATCCAAAAACAGATGCAGAAAGG + Intronic
1151966535 17:77434467-77434489 CTGCAGACTCAGAGGCAGTACGG - Intronic
1152065300 17:78109235-78109257 CAGCAGACACAGAGGCATCATGG + Intergenic
1152133658 17:78491831-78491853 CTGGAAAAACTGAGCCAGCCAGG - Intronic
1152376266 17:79920325-79920347 CTGGGACAATAGAGGCAGCAAGG + Intergenic
1152376403 17:79920982-79921004 CTGAGAAAACAGAGGTGGCAAGG - Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1152897863 17:82923632-82923654 ATCCTAAAACAAAGGCAGCACGG - Exonic
1153250038 18:3112310-3112332 CTGCCACAACAGGGCCAGCAAGG + Exonic
1153263836 18:3248266-3248288 CTGCAACAACAGCTGCAGCAGGG - Intronic
1153400140 18:4675980-4676002 TTTCAGAAACAGAGGCACCAAGG - Intergenic
1153844108 18:9033121-9033143 ATGCAAGAACAGTGGAAGCATGG + Intergenic
1155021912 18:21904199-21904221 CAGCTAAAATAGAGGTAGCATGG - Intergenic
1155844980 18:30695021-30695043 CAGCAACAACAGTGGCAGTATGG + Intergenic
1156263544 18:35466706-35466728 CCGCAAAAACAATGTCAGCAGGG + Intronic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1158964699 18:62612153-62612175 CTGCAGGAACGGAGGCAGCCAGG - Intergenic
1159050113 18:63413850-63413872 CTGCTACAATAGAGGAAGCATGG - Intronic
1159325691 18:66913710-66913732 TTTCAAAATCAGAGGCAGGAAGG + Intergenic
1159508954 18:69371315-69371337 CAGCAAAAAAAGAGGAAGCTAGG + Intergenic
1162066994 19:8131830-8131852 CTGCAGAAGCAGTGGCGGCACGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164945343 19:32288561-32288583 TGGGAAAAACAGAGGAAGCAGGG - Intergenic
1165012913 19:32861857-32861879 CAGCCAAATCAGAGGCAGCCAGG - Intronic
1165103009 19:33450043-33450065 CTGCGGAGACAGAGGCAGCTTGG - Intronic
1165241472 19:34471906-34471928 CTGCAAAAATAAAGGCAGGCAGG - Intergenic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166902839 19:46079413-46079435 CTGCAAAACCAGGTGCACCATGG - Intergenic
1167221424 19:48201305-48201327 CTGCAAAGGCAGGGGCTGCAGGG - Intronic
1167880073 19:52450204-52450226 CCTCAAAAACACAGGCAACAAGG - Intronic
927010279 2:18896990-18897012 ATGCAAACAGAGGGGCAGCATGG - Intergenic
927803191 2:26120508-26120530 CTGCTAAAACAAAGGCAACTTGG - Intronic
927954547 2:27199438-27199460 CTGCAGACACAGGGACAGCAGGG + Intergenic
928650464 2:33398643-33398665 CTGGAAATACAGAAACAGCATGG + Exonic
928752465 2:34486706-34486728 CAATAAAAAGAGAGGCAGCAAGG - Intergenic
929173108 2:38950911-38950933 CTACAAAAATACATGCAGCAGGG - Intronic
929279423 2:40061844-40061866 CTGCAAAAAGAAAGGCATCAAGG - Intergenic
929295547 2:40242427-40242449 CAACATAAACACAGGCAGCATGG - Intronic
929993974 2:46813405-46813427 CAGCAAAAACAGAGACTGCTGGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
931364547 2:61607811-61607833 CTGAAAAAATAGAAGCAGCCTGG + Intergenic
933839358 2:86274151-86274173 CTGCATAAACATAGGAAGAAAGG + Intronic
934148753 2:89123541-89123563 CTGCAAGAAAAGAGGCACCTAGG + Intergenic
934218545 2:90058502-90058524 CTGCAAGAAAAGAGGCACCTAGG - Intergenic
934756061 2:96825531-96825553 CTGCAAAAACAAAAGCACCTAGG - Intronic
935143394 2:100376432-100376454 CACCATAAACAGGGGCAGCAAGG - Intergenic
935225853 2:101052346-101052368 CTGGCAATACAGAGCCAGCAAGG + Intronic
935264761 2:101384751-101384773 CTCGAAAGACTGAGGCAGCAGGG + Intronic
935296111 2:101651063-101651085 CTCCAAGAACACAGGCAGCCAGG + Intergenic
935468992 2:103434176-103434198 CTGCAAAAGCAGAGACTGCCAGG - Intergenic
935717377 2:105951141-105951163 CTACAGATTCAGAGGCAGCAGGG + Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936927200 2:117749357-117749379 CTGAGAAAACAGAAGCAGCTGGG - Intergenic
937723379 2:125129583-125129605 CTACAAAAACAAAAACAGCATGG + Intergenic
938133040 2:128733553-128733575 ATGCAAAGACAGAGCCAGCAGGG + Intergenic
938575598 2:132600240-132600262 CTGCAAAAACAGTGGTAAGAGGG + Intronic
939489056 2:142855028-142855050 CTGCAAAAGCAAAGACAGCAGGG - Intergenic
939649401 2:144742803-144742825 CTGCAAAAACAGCTGCAAAATGG - Intergenic
939722533 2:145672266-145672288 CTGAAGAAACAGAGGCAAAAAGG - Intergenic
939904030 2:147888198-147888220 CTGCAATAATAAAGACAGCAAGG - Intronic
940216556 2:151309372-151309394 GTCCGAAAACAGAGTCAGCAAGG - Intergenic
940291656 2:152083306-152083328 CTGCAAAAAGAAAGCAAGCAAGG + Intronic
941629121 2:167865052-167865074 CTGCATAAACATAGGTAGCTGGG - Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
944770344 2:202907907-202907929 CGGCAATTTCAGAGGCAGCAGGG + Exonic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
945828877 2:214758916-214758938 CTGCAAAAACATATGCAAAAAGG + Intronic
945905450 2:215587868-215587890 TTGCTAAAAGAGAGACAGCATGG - Intergenic
946822752 2:223647263-223647285 CAGGAAAGACAGAGGCTGCAGGG - Intergenic
947165279 2:227255319-227255341 CTGGAAAAACGGAAGCAGCAGGG + Intronic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
1168945616 20:1754139-1754161 CTTCAAAAGCACAGGCAACAAGG + Intergenic
1169450851 20:5709654-5709676 CTAGAAAAACAGAGGTGGCATGG + Intergenic
1171450991 20:25236225-25236247 CAGCCAAAACAGAGACTGCATGG - Intergenic
1172230213 20:33331347-33331369 CTGCACAAAAGGAGGCAGCAGGG + Intergenic
1172637967 20:36422735-36422757 CTGCAGACACAGAGGCACCATGG + Intronic
1174208560 20:48858678-48858700 CTGAAAATAGACAGGCAGCAGGG + Intergenic
1174486208 20:50862803-50862825 GTGCAAAACGAGAGGCAGCCTGG - Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175084305 20:56445803-56445825 CTCCAAAAGCAGAGACAGCTGGG - Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176914191 21:14605085-14605107 CTTCAAATACAGAGGCAGCAAGG + Intronic
1177421030 21:20857144-20857166 CTGCAAAGACAGAGCAATCAGGG - Intergenic
1178044268 21:28676528-28676550 CTGAAAATACAGAGACAGCCAGG + Intergenic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1180477493 22:15724605-15724627 CTGCAAAGGCAGTGGCAGAAAGG - Intergenic
1180611577 22:17101676-17101698 GTGCAAAGACAGGGGCAGCCGGG + Intronic
1180698584 22:17769700-17769722 CTCCACACACAGAGGCAGCTGGG + Intronic
1181685153 22:24523081-24523103 CTGCAAATAGAGATGCAGAAAGG + Intronic
1182133243 22:27874762-27874784 CTGCAAAGAAAGAGACAGCAGGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182678244 22:32057220-32057242 CTTCACAATCAGAGGCAGCCAGG - Intronic
1184693902 22:46129471-46129493 CTGCAGCAAGAGAGGCACCAAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
1185312071 22:50161754-50161776 CTCCAAAAACTGCGCCAGCAGGG - Intergenic
949127752 3:466822-466844 ATGGAAATACAGAGCCAGCAAGG - Intergenic
949858638 3:8485258-8485280 CTGCAAAAACAAAGGCTGTGGGG - Intergenic
950527025 3:13530226-13530248 CTGAGAAAACTGAGGCAGAAAGG - Intergenic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950856361 3:16109396-16109418 CTGACAAATCTGAGGCAGCAGGG + Intergenic
952803045 3:37315453-37315475 CCCAAAAAACAGAGGAAGCACGG + Exonic
953880941 3:46691000-46691022 CTGCAGAGAGAGAGGCAGGAAGG + Intronic
955056363 3:55459276-55459298 CTGCAAAAATGGCTGCAGCAAGG + Intergenic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
956487039 3:69733850-69733872 CTGCAAGCTCAGAGGCACCAAGG - Intergenic
957012041 3:75017901-75017923 TTGCAGAATCAGAGGTAGCATGG + Intergenic
957992196 3:87640378-87640400 CTGCAATAACCCAAGCAGCATGG - Intergenic
960089818 3:113627872-113627894 CTGCAAGAAAGGAGGCAGAAGGG + Exonic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960757028 3:121025791-121025813 ATTCAAAAACAGAGGCAGTAAGG - Intronic
961114430 3:124316558-124316580 CTGCAGAAAGAGGAGCAGCAGGG - Intronic
961166199 3:124765531-124765553 CTGCACAGCCAAAGGCAGCAAGG - Intronic
961871396 3:129991105-129991127 CTGATAAAACAGAGGCACCATGG + Intergenic
961960399 3:130848545-130848567 CTGCAAAAACAGAGGCGAAGGGG - Intergenic
962020581 3:131496974-131496996 CTGCAGAAGCAGAGACAACATGG - Intronic
963834917 3:150048388-150048410 GTTCACACACAGAGGCAGCAAGG - Intronic
964147447 3:153482640-153482662 CTGCAAGAAAAGAGGAATCAGGG + Intergenic
964184197 3:153923209-153923231 CTGTTATATCAGAGGCAGCATGG + Intergenic
965090440 3:164155593-164155615 TGGCAAAAGCAGAAGCAGCAGGG + Intergenic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
965624092 3:170669854-170669876 TTGCAGATCCAGAGGCAGCATGG - Intronic
968563902 4:1299308-1299330 CTGTGACAACAGAGGCATCAAGG - Intronic
968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG + Intronic
969484937 4:7466929-7466951 CTCCAAAGAGAAAGGCAGCAGGG - Intronic
969636222 4:8370711-8370733 CTGCAACCACAGAGCCAGCATGG + Intronic
970083462 4:12317171-12317193 CTATGAAAACAGAGACAGCATGG - Intergenic
970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG + Intergenic
972623099 4:40768352-40768374 CTACAAAAACACAGGCATAATGG - Intronic
974383135 4:61168668-61168690 CTGCAATAACCAAAGCAGCATGG + Intergenic
974688079 4:65257595-65257617 CTGCATAAACAGGGGAAGAAGGG + Intergenic
975667156 4:76743394-76743416 CTCCAAAAACAAAGTCATCATGG + Intronic
975667287 4:76744890-76744912 CTCCAAAAACAAAGTCATCATGG + Intronic
975711125 4:77160513-77160535 CCCCAAAAAAAAAGGCAGCAGGG - Intronic
975811305 4:78172944-78172966 CTGCCAACACAGAGACCGCAAGG - Intronic
976854714 4:89590160-89590182 CTGCAAAAGCAGAGGCACTGGGG - Intergenic
977657739 4:99542024-99542046 CAGCAAAACCAGTGTCAGCAAGG + Exonic
977931236 4:102751472-102751494 CAGCAAATTCAGAGGCGGCAGGG - Intronic
978846385 4:113277908-113277930 CTGCAGAATCTGCGGCAGCACGG - Exonic
979535426 4:121814488-121814510 CTACAAAAAAAAAGACAGCAGGG - Intronic
979632207 4:122916130-122916152 CAGCAAAAACAGAAACAGCCAGG + Intronic
980279000 4:130693618-130693640 CAGCAAAAGTAGAGGGAGCAAGG + Intergenic
981588879 4:146334660-146334682 TTGCAACTAAAGAGGCAGCAGGG + Intronic
982216404 4:153086159-153086181 TTACAAAAACAGAGGCAGCCAGG - Intergenic
985816481 5:2131803-2131825 GAGCGGAAACAGAGGCAGCATGG - Intergenic
986377667 5:7148793-7148815 ATGAAAAAAGAGAAGCAGCAAGG + Intergenic
986643543 5:9894431-9894453 ACACACAAACAGAGGCAGCAGGG + Intergenic
987372359 5:17204652-17204674 TTGCAAAAACAGAAGCAGAAAGG + Intronic
987492090 5:18594170-18594192 CTGCAGAAGCAGAGGCCTCATGG - Intergenic
988496083 5:31747465-31747487 CTGAAAAAACAGCAGAAGCAGGG - Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
994019297 5:95004789-95004811 CTGCAAAAGCAGAGTCCCCATGG + Intronic
994662250 5:102668030-102668052 CTGCAAAACAAGTGGCATCAGGG - Intergenic
995153151 5:108875391-108875413 ATGCAAAAAAAGAGGCAGATGGG - Intronic
995525279 5:113045859-113045881 GCGCAAAAGCAGAGGCAACAGGG - Intronic
995525668 5:113048987-113049009 ATACAAGAACTGAGGCAGCAGGG + Intronic
996555303 5:124772351-124772373 TTACAAAAACAGAACCAGCAAGG + Intergenic
997392981 5:133532096-133532118 CTTCTAAAAGAGAGGCAGGAGGG + Intronic
997690605 5:135825413-135825435 CTGCAGAGACAGAGGAGGCAAGG + Intergenic
998104145 5:139457605-139457627 CTGCAAGGACAGAGGCAGATAGG + Intronic
998556038 5:143124636-143124658 GGGCAAACACAGAAGCAGCAAGG + Intronic
999065544 5:148682003-148682025 CTGTACAAAAACAGGCAGCAGGG - Intergenic
999355121 5:150920795-150920817 ATGCAAAAATAGAAACAGCAAGG + Intergenic
999505640 5:152193140-152193162 TAGGAGAAACAGAGGCAGCAGGG - Intergenic
999798640 5:155011627-155011649 ATGCAATTACAGAGTCAGCAGGG - Intergenic
1000130363 5:158291273-158291295 CAGAGAAAAAAGAGGCAGCAAGG + Intergenic
1000276077 5:159735852-159735874 CTGTAAAAACAGAGGAGCCAAGG - Intergenic
1001583092 5:172813238-172813260 GTCCAAAAAGAGAGTCAGCAAGG + Intergenic
1002441842 5:179268406-179268428 CTGCAAACTCAGAGCCTGCAGGG - Intronic
1002554098 5:180020774-180020796 CTTCACACACAGAGGCAGAAGGG + Intronic
1002830828 6:818941-818963 CTGCTACAACCCAGGCAGCAGGG - Intergenic
1002967330 6:1978945-1978967 CTGGAAAAACTGAGGCAACTAGG + Intronic
1003879996 6:10471244-10471266 CTGCAGAAAGAGAGGCTGCAGGG + Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1005151300 6:22754333-22754355 TTACAAAAACACAGGCAGCAGGG - Intergenic
1005167436 6:22940561-22940583 CTTAAAAAACAGAGGCTCCATGG - Intergenic
1006828438 6:36954244-36954266 CTGCCAAAACACAGATAGCAAGG + Intronic
1008154122 6:47993046-47993068 CTGCAAAAGCATGGGCACCATGG + Intronic
1008458891 6:51744407-51744429 TTCCTAAAACAGAGGCAGAATGG - Exonic
1009383848 6:63065710-63065732 CTCTAAAATTAGAGGCAGCAGGG - Intergenic
1010869661 6:81021788-81021810 CAGGATTAACAGAGGCAGCATGG + Intergenic
1011445342 6:87433146-87433168 CTGAATAAAATGAGGCAGCAAGG - Intronic
1012030725 6:94058411-94058433 CTGCAAATACACAGGTAGTATGG - Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013688536 6:112613222-112613244 TTTAAAAAACAGAGGCAGAAAGG - Intergenic
1014074312 6:117219143-117219165 CTGCAAAAATAGAAGCTCCAAGG - Intergenic
1014759203 6:125337194-125337216 TTGAAAAAAAAGAGGAAGCAAGG + Intergenic
1016539966 6:145153612-145153634 TTCCAATAACTGAGGCAGCAGGG - Intergenic
1016805699 6:148210235-148210257 CTGCAAAAACAGACCAGGCATGG + Intergenic
1017122648 6:151038991-151039013 CTTCAAAGAAAGAGGCAGGAAGG + Intronic
1017694341 6:156999587-156999609 CTTAAGAAACACAGGCAGCAGGG + Intronic
1018500627 6:164407006-164407028 CTGAAATAACAGAGCCAGGAAGG - Intergenic
1018646451 6:165953136-165953158 CTGCAAGAACAGAGGCACTGAGG - Intronic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1019714151 7:2530635-2530657 CTGCAACCACAGGGGCTGCAGGG + Intergenic
1020474714 7:8581916-8581938 TAGCACAAGCAGAGGCAGCAGGG - Intronic
1021281694 7:18727693-18727715 GAGGTAAAACAGAGGCAGCAGGG - Exonic
1022370068 7:29762590-29762612 CAGCAAAAACAGAGACATAAAGG - Intergenic
1022945376 7:35278818-35278840 CTGCAAAAACAGAGTCCAGAGGG - Intergenic
1024135839 7:46407066-46407088 CTCCTAAAACAGAGGGAGCCTGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026590267 7:71688380-71688402 CTGCAAAGAGAGTGGCTGCAAGG - Intronic
1028456460 7:91043229-91043251 TTGTAGAAACAGAGGCAGCCAGG + Intronic
1029369295 7:100137880-100137902 TTGCAAAAACTGAGGGAGGAAGG + Intergenic
1030141470 7:106308540-106308562 ATGCAAAAAAAGATACAGCAGGG - Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030523125 7:110622562-110622584 CTGCAAGTCCAGAGGCAGTATGG + Intergenic
1030563582 7:111122431-111122453 CTGCAAATACTGAAGAAGCATGG + Exonic
1032333238 7:130999758-130999780 TTGCTCACACAGAGGCAGCATGG - Intergenic
1033067533 7:138170503-138170525 TTCCAAACACAAAGGCAGCAGGG + Intergenic
1033448046 7:141439056-141439078 CTGCAGACAAAGAGCCAGCATGG - Intronic
1033598135 7:142870866-142870888 CAGCAACACCTGAGGCAGCAGGG + Exonic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034402298 7:150870789-150870811 CTGCAAACACAGCAGCATCAAGG - Intergenic
1034788618 7:153947758-153947780 CTCCAAAGGCAGAGGCAGCCGGG - Intronic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1034852107 7:154503078-154503100 GAGCAGAAACAGAGGAAGCAAGG - Intronic
1035211542 7:157332326-157332348 CAGCAAGCACAGAGGCTGCAGGG - Intergenic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1037063294 8:14543632-14543654 CTGTAAAAACTGAGGAATCACGG + Intronic
1038018859 8:23536429-23536451 TGGCAGGAACAGAGGCAGCAGGG - Intronic
1038723391 8:30058234-30058256 CAGCACATACAGAGGGAGCATGG - Intergenic
1039671910 8:39611180-39611202 CAGAAAAAACAGAGGCCACATGG - Intronic
1040091921 8:43407906-43407928 CTGGAAAAACTGAGGCAACAAGG - Intergenic
1040400722 8:47046511-47046533 CCGGAAAAACTGAGGCAACAAGG + Intergenic
1040404593 8:47087420-47087442 CTGGAAAATCTGAGGCAGCTAGG - Intergenic
1041528179 8:58832638-58832660 CTGCTAAATTAGAAGCAGCAGGG - Intronic
1041930902 8:63285209-63285231 CTACAAAAACAAAGGAAGGAGGG - Intergenic
1042988447 8:74610551-74610573 CTGAAAAAAAAGAGGCAACTTGG + Intronic
1043261709 8:78208373-78208395 GAGTAAAAACAGAAGCAGCATGG + Intergenic
1043495887 8:80799505-80799527 CAGGAAAAACTGAGGCAGCTAGG + Intronic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG + Intergenic
1046821610 8:118639746-118639768 CTCCAAGAACAAAAGCAGCATGG - Intergenic
1047351341 8:124077740-124077762 CTGCAATGTCAGAGGCAGGAGGG - Intronic
1047729631 8:127716226-127716248 CTGAGAAAACAGAGTAAGCAAGG - Intergenic
1048773242 8:137918483-137918505 CTTCGAAGACAGAGGCAGGAGGG + Intergenic
1050133849 9:2441230-2441252 CTGCACTGACAGAGGTAGCAGGG + Intergenic
1050175061 9:2861264-2861286 CTGGAAAGAAATAGGCAGCATGG + Intergenic
1050233006 9:3548512-3548534 GTTCAAAAACAGTGGCAGCAGGG - Intergenic
1051410496 9:16785322-16785344 CTGCAAAAACTGAGGCCACGGGG + Intronic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1055817721 9:80226829-80226851 CTACAATAACAAAAGCAGCATGG - Intergenic
1056062665 9:82900155-82900177 CTGAATAAACTGAGCCAGCAAGG - Intergenic
1057230327 9:93317782-93317804 CTGCAAGAAGACTGGCAGCACGG - Intronic
1058899817 9:109432323-109432345 TTGGCAAAACAGTGGCAGCAAGG - Intronic
1059386645 9:113969775-113969797 CAGCAACAGCAGCGGCAGCATGG - Intronic
1059417749 9:114172412-114172434 CTACAAAAACAGGCTCAGCATGG - Intronic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1060130939 9:121098796-121098818 CTGCCAAAACATAAGCTGCATGG - Intronic
1060600087 9:124871450-124871472 CTGCAGATAGAGCGGCAGCATGG + Intronic
1061118162 9:128627591-128627613 GTGTAAAACCAGAGGCAGCCTGG + Intronic
1061891814 9:133625638-133625660 CTGCAAAAGCAGAGCCCTCATGG - Intergenic
1185920709 X:4088870-4088892 ATTCAGAACCAGAGGCAGCAAGG - Intergenic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1187846886 X:23548451-23548473 CAGCAAAACTAGAAGCAGCAGGG + Intergenic
1188489255 X:30720352-30720374 CAGCACAAACATAGGCATCAAGG + Intronic
1189669588 X:43394128-43394150 TTGCAAAAACAAATGAAGCATGG + Intergenic
1189921100 X:45903992-45904014 CCACAAAAACAGAGGGAGAAGGG + Intergenic
1192723316 X:73723406-73723428 CTGGAAAAACTGAGGCAACTAGG - Intergenic
1194323465 X:92480932-92480954 CAGCAGCGACAGAGGCAGCATGG + Intronic
1194425727 X:93735178-93735200 CTGCAATAACAAAAACAGCATGG - Intergenic
1194542884 X:95196552-95196574 CCGCAGAAGCAGCGGCAGCATGG + Intergenic
1195361167 X:104085018-104085040 CTGCCAAAGCAGAGGCAGAGAGG + Intergenic
1195536733 X:106015898-106015920 CTGCAAATACAGAAGCAATAGGG + Intergenic
1195603677 X:106777574-106777596 CTGCCACACCGGAGGCAGCAAGG + Intronic
1196409847 X:115406785-115406807 CTGCAGAAACAGAGCCACAAAGG - Intergenic
1197809307 X:130427386-130427408 CTTGGAACACAGAGGCAGCATGG + Intergenic
1198227332 X:134657511-134657533 CTGTTACTACAGAGGCAGCAGGG - Intronic
1199732703 X:150652222-150652244 GTGGAAAAACAGAGCCAGCATGG + Intronic
1200135740 X:153873771-153873793 ATGGAAACTCAGAGGCAGCAGGG - Intronic
1200165695 X:154033636-154033658 CTGCAACAACAGGGGCAGCTTGG + Intronic
1200631566 Y:5594098-5594120 CAGCAGCGACAGAGGCAGCATGG + Intronic
1201460950 Y:14223843-14223865 CTGCATAAAATCAGGCAGCAAGG + Intergenic